Mutagenetix > Incidental Mutation

Incidental Mutation 'R7889:Cep72'

609231

Institutional Source

Beutler Lab

Gene Symbol

Cep72

Ensembl Gene

ENSMUSG00000021572

Gene Name

centrosomal protein 72

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.104) question?

Stock #

R7889 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

74036500-74062299 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 74050122 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 380 (S380T)

Ref Sequence

ENSEMBL: ENSMUSP00000037788 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036456] [ENSMUST00000220483] [ENSMUST00000221122] [ENSMUST00000222609]

AlphaFold

Q9D3R3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000036456
AA Change: S380T

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000037788
Gene: ENSMUSG00000021572
AA Change: S380T

Domain	Start	End	E-Value	Type
LRR	52	73	2.92e1	SMART
LRR	74	96	5.34e-1	SMART
LRRcap	116	134	1.89e-4	SMART
low complexity region	307	319	N/A	INTRINSIC
low complexity region	378	389	N/A	INTRINSIC
low complexity region	417	428	N/A	INTRINSIC
coiled coil region	485	531	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000220483

Predicted Effect

probably benign
Transcript: ENSMUST00000221122

Predicted Effect

probably benign
Transcript: ENSMUST00000222609

Predicted Effect

probably benign
Transcript: ENSMUST00000223028

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the leucine-rich-repeat (LRR) superfamily of proteins. The protein is localized to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Angptl3	C	T	4: 99,031,071	L23F	probably benign	Het
Art2a-ps	C	T	7: 101,555,211	S40N	not run	Het
Ash1l	A	G	3: 88,966,038	T43A	probably benign	Het
Atp1a2	G	A	1: 172,278,064		probably null	Het
Azi2	A	G	9: 118,061,915	E336G	probably benign	Het
Cap2	A	G	13: 46,646,575	H419R	probably damaging	Het
Ccdc14	T	A	16: 34,723,836	S903T	probably damaging	Het
Clca3a2	C	A	3: 144,810,813	E341*	probably null	Het
Clcnkb	T	G	4: 141,410,604	I294L	probably benign	Het
Cyp2d9	T	A	15: 82,455,826	M350K	probably damaging	Het
Dhx40	T	G	11: 86,798,967	I266L	probably benign	Het
Dnah5	G	T	15: 28,448,414	E4208*	probably null	Het
Ephb2	T	C	4: 136,771,042	N242S	probably damaging	Het
Fam13b	A	T	18: 34,457,691	F478Y	probably benign	Het
Fastkd2	C	G	1: 63,735,460		probably null	Het
Fbxo40	T	A	16: 36,969,650	D366V	probably damaging	Het
Fhod3	A	T	18: 24,770,494	K95M	probably damaging	Het
Foxo3	T	A	10: 42,275,027	Q136L	probably benign	Het
Gadl1	A	T	9: 115,954,815	Q236L	possibly damaging	Het
Galnt13	A	G	2: 55,112,861	D560G	probably benign	Het
Ghsr	A	G	3: 27,372,166	S124G	probably benign	Het
Gkn2	A	G	6: 87,378,286		probably null	Het
Glyctk	T	A	9: 106,156,439	R68W	unknown	Het
Gm10031	G	A	1: 156,525,395	A389T	probably benign	Het
Gm14025	T	C	2: 129,036,994	E1004G	unknown	Het
Gm5157	G	A	7: 21,184,716	P301S	unknown	Het
Hdc	A	T	2: 126,616,210	I64N	probably damaging	Het
Helq	A	T	5: 100,792,561		probably null	Het
Ighv1-43	T	C	12: 114,945,963	Y113C	probably damaging	Het
Ipo9	T	C	1: 135,406,853	T273A	probably benign	Het
Itga4	G	A	2: 79,316,045	V774I	probably benign	Het
Itpr3	T	C	17: 27,116,777	L2287P	probably damaging	Het
Llgl1	T	A	11: 60,707,312	I394N	probably damaging	Het
Mta1	G	A	12: 113,131,688	R487H	probably benign	Het
Neb	T	C	2: 52,147,669	D7049G	probably benign	Het
Nlrp4f	G	A	13: 65,195,018	S271F	probably damaging	Het
Noxo1	A	G	17: 24,699,382	D172G	probably damaging	Het
Nup155	T	A	15: 8,121,507	V347E	probably damaging	Het
Oaf	G	T	9: 43,222,671	A251E	possibly damaging	Het
Pds5b	T	A	5: 150,792,172	F1039I	probably damaging	Het
Pla2g12b	T	A	10: 59,421,240		probably null	Het
Prmt3	A	G	7: 49,787,301	D208G	possibly damaging	Het
Ptcd3	G	A	6: 71,888,608	T441M	probably damaging	Het
Rabl6	A	G	2: 25,584,774		probably null	Het
Shtn1	T	A	19: 59,003,896	I417F	probably damaging	Het
Slc20a2	T	C	8: 22,540,401	S158P	probably damaging	Het
Sltm	C	G	9: 70,586,673	P802R	possibly damaging	Het
Spata5	A	G	3: 37,578,810	D855G	probably benign	Het
Spef2	T	C	15: 9,717,563	Y232C	probably damaging	Het
Stard9	C	T	2: 120,704,461	T3733I	probably benign	Het
Thrap3	A	T	4: 126,178,062	F512L	probably benign	Het
Tmem150c	A	T	5: 100,093,104	I30K	probably damaging	Het
Tnnt1	C	T	7: 4,508,583	A168T	probably damaging	Het
Trak2	A	G	1: 58,918,824	L308P	probably damaging	Het
Trp53i11	T	C	2: 93,198,899	L81P	probably damaging	Het
Usp16	T	C	16: 87,474,584	Y344H	probably benign	Het
Wdr60	T	A	12: 116,255,939	K128*	probably null	Het
Xrcc5	G	T	1: 72,356,826	V593L	probably benign	Het
Zcchc14	A	T	8: 121,604,895	H576Q	unknown	Het
Zfp616	T	A	11: 74,085,445	C847S	probably damaging	Het
Zfp626	A	T	7: 27,819,499	Y635F	probably benign	Het
Zfp799	G	A	17: 32,819,499	R598*	probably null	Het
Zfp831	A	G	2: 174,645,304	K591E	possibly damaging	Het

Other mutations in Cep72

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Cep72	APN	13	74062268	unclassified	probably benign
IGL01373:Cep72	APN	13	74059459	missense	probably damaging	1.00
IGL02415:Cep72	APN	13	74050154	missense	probably benign	0.31
IGL03372:Cep72	APN	13	74043518	missense	possibly damaging	0.47
R0608:Cep72	UTSW	13	74038304	missense	probably damaging	1.00
R0884:Cep72	UTSW	13	74054881	critical splice donor site	probably null
R2400:Cep72	UTSW	13	74048977	missense	probably damaging	0.99
R4906:Cep72	UTSW	13	74059465	missense	probably damaging	1.00
R5534:Cep72	UTSW	13	74062216	missense	probably benign	0.05
R5567:Cep72	UTSW	13	74040141	missense	probably benign	0.00
R5570:Cep72	UTSW	13	74040141	missense	probably benign	0.00
R5816:Cep72	UTSW	13	74049031	missense	probably benign	0.43
R6310:Cep72	UTSW	13	74053025	missense	possibly damaging	0.94
R6513:Cep72	UTSW	13	74058463	missense	probably damaging	1.00
R6848:Cep72	UTSW	13	74038276	missense	possibly damaging	0.85
R6936:Cep72	UTSW	13	74040087	missense	probably damaging	1.00
R7000:Cep72	UTSW	13	74058325	missense	probably damaging	0.96
R7006:Cep72	UTSW	13	74050308	nonsense	probably null
R7074:Cep72	UTSW	13	74051580	missense	probably benign	0.16
R7640:Cep72	UTSW	13	74058488	nonsense	probably null
R8260:Cep72	UTSW	13	74058346	missense	probably damaging	1.00
R8751:Cep72	UTSW	13	74050184	missense	possibly damaging	0.60
R8789:Cep72	UTSW	13	74038248	missense	possibly damaging	0.83
R9202:Cep72	UTSW	13	74050301	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGCAACATTCATTGTGGGGTC -3'
(R):5'- TGCTTCATCTGCTCAGAAATCAAG -3'

Sequencing Primer
(F):5'- AATAAGGCAGGTCTCCAG -3'
(R):5'- AAACAGTAAATCCTTTGCCTGTCC -3'

Posted On

2019-12-20