Incidental Mutation 'R7889:Cep72'
ID609231
Institutional Source Beutler Lab
Gene Symbol Cep72
Ensembl Gene ENSMUSG00000021572
Gene Namecentrosomal protein 72
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R7889 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location74036500-74062299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74050122 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 380 (S380T)
Ref Sequence ENSEMBL: ENSMUSP00000037788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036456] [ENSMUST00000220483] [ENSMUST00000221122] [ENSMUST00000222609]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036456
AA Change: S380T

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037788
Gene: ENSMUSG00000021572
AA Change: S380T

DomainStartEndE-ValueType
LRR 52 73 2.92e1 SMART
LRR 74 96 5.34e-1 SMART
LRRcap 116 134 1.89e-4 SMART
low complexity region 307 319 N/A INTRINSIC
low complexity region 378 389 N/A INTRINSIC
low complexity region 417 428 N/A INTRINSIC
coiled coil region 485 531 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220483
Predicted Effect probably benign
Transcript: ENSMUST00000221122
Predicted Effect probably benign
Transcript: ENSMUST00000222609
Predicted Effect probably benign
Transcript: ENSMUST00000223028
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the leucine-rich-repeat (LRR) superfamily of proteins. The protein is localized to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl3 C T 4: 99,031,071 L23F probably benign Het
Art2a-ps C T 7: 101,555,211 S40N not run Het
Ash1l A G 3: 88,966,038 T43A probably benign Het
Azi2 A G 9: 118,061,915 E336G probably benign Het
Cap2 A G 13: 46,646,575 H419R probably damaging Het
Ccdc14 T A 16: 34,723,836 S903T probably damaging Het
Clca3a2 C A 3: 144,810,813 E341* probably null Het
Clcnkb T G 4: 141,410,604 I294L probably benign Het
Cyp2d9 T A 15: 82,455,826 M350K probably damaging Het
Dhx40 T G 11: 86,798,967 I266L probably benign Het
Dnah5 G T 15: 28,448,414 E4208* probably null Het
Ephb2 T C 4: 136,771,042 N242S probably damaging Het
Fam13b A T 18: 34,457,691 F478Y probably benign Het
Fbxo40 T A 16: 36,969,650 D366V probably damaging Het
Fhod3 A T 18: 24,770,494 K95M probably damaging Het
Foxo3 T A 10: 42,275,027 Q136L probably benign Het
Gadl1 A T 9: 115,954,815 Q236L possibly damaging Het
Galnt13 A G 2: 55,112,861 D560G probably benign Het
Ghsr A G 3: 27,372,166 S124G probably benign Het
Glyctk T A 9: 106,156,439 R68W unknown Het
Gm10031 G A 1: 156,525,395 A389T probably benign Het
Gm14025 T C 2: 129,036,994 E1004G unknown Het
Gm5157 G A 7: 21,184,716 P301S unknown Het
Hdc A T 2: 126,616,210 I64N probably damaging Het
Ighv1-43 T C 12: 114,945,963 Y113C probably damaging Het
Ipo9 T C 1: 135,406,853 T273A probably benign Het
Itga4 G A 2: 79,316,045 V774I probably benign Het
Itpr3 T C 17: 27,116,777 L2287P probably damaging Het
Llgl1 T A 11: 60,707,312 I394N probably damaging Het
Mta1 G A 12: 113,131,688 R487H probably benign Het
Neb T C 2: 52,147,669 D7049G probably benign Het
Nlrp4f G A 13: 65,195,018 S271F probably damaging Het
Noxo1 A G 17: 24,699,382 D172G probably damaging Het
Nup155 T A 15: 8,121,507 V347E probably damaging Het
Oaf G T 9: 43,222,671 A251E possibly damaging Het
Pds5b T A 5: 150,792,172 F1039I probably damaging Het
Prmt3 A G 7: 49,787,301 D208G possibly damaging Het
Ptcd3 G A 6: 71,888,608 T441M probably damaging Het
Rabl6 A G 2: 25,584,774 probably null Het
Shtn1 T A 19: 59,003,896 I417F probably damaging Het
Slc20a2 T C 8: 22,540,401 S158P probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Spata5 A G 3: 37,578,810 D855G probably benign Het
Spef2 T C 15: 9,717,563 Y232C probably damaging Het
Stard9 C T 2: 120,704,461 T3733I probably benign Het
Thrap3 A T 4: 126,178,062 F512L probably benign Het
Tmem150c A T 5: 100,093,104 I30K probably damaging Het
Tnnt1 C T 7: 4,508,583 A168T probably damaging Het
Trak2 A G 1: 58,918,824 L308P probably damaging Het
Trp53i11 T C 2: 93,198,899 L81P probably damaging Het
Usp16 T C 16: 87,474,584 Y344H probably benign Het
Wdr60 T A 12: 116,255,939 K128* probably null Het
Xrcc5 G T 1: 72,356,826 V593L probably benign Het
Zcchc14 A T 8: 121,604,895 H576Q unknown Het
Zfp616 T A 11: 74,085,445 C847S probably damaging Het
Zfp626 A T 7: 27,819,499 Y635F probably benign Het
Zfp799 G A 17: 32,819,499 R598* probably null Het
Zfp831 A G 2: 174,645,304 K591E possibly damaging Het
Other mutations in Cep72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Cep72 APN 13 74062268 unclassified probably benign
IGL01373:Cep72 APN 13 74059459 missense probably damaging 1.00
IGL02415:Cep72 APN 13 74050154 missense probably benign 0.31
IGL03372:Cep72 APN 13 74043518 missense possibly damaging 0.47
R0608:Cep72 UTSW 13 74038304 missense probably damaging 1.00
R0884:Cep72 UTSW 13 74054881 critical splice donor site probably null
R2400:Cep72 UTSW 13 74048977 missense probably damaging 0.99
R4906:Cep72 UTSW 13 74059465 missense probably damaging 1.00
R5534:Cep72 UTSW 13 74062216 missense probably benign 0.05
R5567:Cep72 UTSW 13 74040141 missense probably benign 0.00
R5570:Cep72 UTSW 13 74040141 missense probably benign 0.00
R5816:Cep72 UTSW 13 74049031 missense probably benign 0.43
R6310:Cep72 UTSW 13 74053025 missense possibly damaging 0.94
R6513:Cep72 UTSW 13 74058463 missense probably damaging 1.00
R6848:Cep72 UTSW 13 74038276 missense possibly damaging 0.85
R6936:Cep72 UTSW 13 74040087 missense probably damaging 1.00
R7000:Cep72 UTSW 13 74058325 missense probably damaging 0.96
R7006:Cep72 UTSW 13 74050308 nonsense probably null
R7074:Cep72 UTSW 13 74051580 missense probably benign 0.16
R7640:Cep72 UTSW 13 74058488 nonsense probably null
R7972:Cep72 UTSW 13 74050122 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- AGCAACATTCATTGTGGGGTC -3'
(R):5'- TGCTTCATCTGCTCAGAAATCAAG -3'

Sequencing Primer
(F):5'- AATAAGGCAGGTCTCCAG -3'
(R):5'- AAACAGTAAATCCTTTGCCTGTCC -3'
Posted On2019-12-20