Incidental Mutation 'R7889:Cep72'
ID 609231
Institutional Source Beutler Lab
Gene Symbol Cep72
Ensembl Gene ENSMUSG00000021572
Gene Name centrosomal protein 72
Synonyms 2610029E11Rik, 4933440J22Rik
MMRRC Submission 045941-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R7889 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 74184619-74210418 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 74198241 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 380 (S380T)
Ref Sequence ENSEMBL: ENSMUSP00000037788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036456] [ENSMUST00000220483] [ENSMUST00000221122] [ENSMUST00000222609]
AlphaFold Q9D3R3
Predicted Effect possibly damaging
Transcript: ENSMUST00000036456
AA Change: S380T

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037788
Gene: ENSMUSG00000021572
AA Change: S380T

DomainStartEndE-ValueType
LRR 52 73 2.92e1 SMART
LRR 74 96 5.34e-1 SMART
LRRcap 116 134 1.89e-4 SMART
low complexity region 307 319 N/A INTRINSIC
low complexity region 378 389 N/A INTRINSIC
low complexity region 417 428 N/A INTRINSIC
coiled coil region 485 531 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220483
Predicted Effect probably benign
Transcript: ENSMUST00000221122
Predicted Effect probably benign
Transcript: ENSMUST00000222609
Predicted Effect probably benign
Transcript: ENSMUST00000223028
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the leucine-rich-repeat (LRR) superfamily of proteins. The protein is localized to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg2a A G 3: 37,632,959 (GRCm39) D855G probably benign Het
Angptl3 C T 4: 98,919,308 (GRCm39) L23F probably benign Het
Art2a C T 7: 101,204,418 (GRCm39) S40N not run Het
Ash1l A G 3: 88,873,345 (GRCm39) T43A probably benign Het
Atp1a2 G A 1: 172,105,631 (GRCm39) probably null Het
Azi2 A G 9: 117,890,983 (GRCm39) E336G probably benign Het
Cap2 A G 13: 46,800,051 (GRCm39) H419R probably damaging Het
Ccdc14 T A 16: 34,544,206 (GRCm39) S903T probably damaging Het
Clca3a2 C A 3: 144,516,574 (GRCm39) E341* probably null Het
Clcnkb T G 4: 141,137,915 (GRCm39) I294L probably benign Het
Csnk2a1-ps3 G A 1: 156,352,965 (GRCm39) A389T probably benign Het
Cyp2d9 T A 15: 82,340,027 (GRCm39) M350K probably damaging Het
Dhx40 T G 11: 86,689,793 (GRCm39) I266L probably benign Het
Dnah5 G T 15: 28,448,560 (GRCm39) E4208* probably null Het
Dync2i1 T A 12: 116,219,559 (GRCm39) K128* probably null Het
Ephb2 T C 4: 136,498,353 (GRCm39) N242S probably damaging Het
Fam13b A T 18: 34,590,744 (GRCm39) F478Y probably benign Het
Fastkd2 C G 1: 63,774,619 (GRCm39) probably null Het
Fbxo40 T A 16: 36,790,012 (GRCm39) D366V probably damaging Het
Fhod3 A T 18: 24,903,551 (GRCm39) K95M probably damaging Het
Foxo3 T A 10: 42,151,023 (GRCm39) Q136L probably benign Het
Gadl1 A T 9: 115,783,883 (GRCm39) Q236L possibly damaging Het
Galnt13 A G 2: 55,002,873 (GRCm39) D560G probably benign Het
Ghsr A G 3: 27,426,315 (GRCm39) S124G probably benign Het
Gkn2 A G 6: 87,355,268 (GRCm39) probably null Het
Glyctk T A 9: 106,033,638 (GRCm39) R68W unknown Het
Gm5157 G A 7: 20,918,641 (GRCm39) P301S unknown Het
Hdc A T 2: 126,458,130 (GRCm39) I64N probably damaging Het
Helq A T 5: 100,940,427 (GRCm39) probably null Het
Ighv1-43 T C 12: 114,909,583 (GRCm39) Y113C probably damaging Het
Ipo9 T C 1: 135,334,591 (GRCm39) T273A probably benign Het
Itga4 G A 2: 79,146,389 (GRCm39) V774I probably benign Het
Itpr3 T C 17: 27,335,751 (GRCm39) L2287P probably damaging Het
Llgl1 T A 11: 60,598,138 (GRCm39) I394N probably damaging Het
Mta1 G A 12: 113,095,308 (GRCm39) R487H probably benign Het
Neb T C 2: 52,037,681 (GRCm39) D7049G probably benign Het
Nlrp4f G A 13: 65,342,832 (GRCm39) S271F probably damaging Het
Noxo1 A G 17: 24,918,356 (GRCm39) D172G probably damaging Het
Nup155 T A 15: 8,150,991 (GRCm39) V347E probably damaging Het
Oaf G T 9: 43,133,968 (GRCm39) A251E possibly damaging Het
Pds5b T A 5: 150,715,637 (GRCm39) F1039I probably damaging Het
Pla2g12b T A 10: 59,257,062 (GRCm39) probably null Het
Prmt3 A G 7: 49,437,049 (GRCm39) D208G possibly damaging Het
Ptcd3 G A 6: 71,865,592 (GRCm39) T441M probably damaging Het
Rabl6 A G 2: 25,474,786 (GRCm39) probably null Het
Shtn1 T A 19: 58,992,328 (GRCm39) I417F probably damaging Het
Slc20a2 T C 8: 23,030,417 (GRCm39) S158P probably damaging Het
Sltm C G 9: 70,493,955 (GRCm39) P802R possibly damaging Het
Spef2 T C 15: 9,717,649 (GRCm39) Y232C probably damaging Het
Stard9 C T 2: 120,534,942 (GRCm39) T3733I probably benign Het
Thrap3 A T 4: 126,071,855 (GRCm39) F512L probably benign Het
Tmem150c A T 5: 100,240,963 (GRCm39) I30K probably damaging Het
Tnnt1 C T 7: 4,511,582 (GRCm39) A168T probably damaging Het
Trak2 A G 1: 58,957,983 (GRCm39) L308P probably damaging Het
Trp53i11 T C 2: 93,029,244 (GRCm39) L81P probably damaging Het
Usp16 T C 16: 87,271,472 (GRCm39) Y344H probably benign Het
Vinac1 T C 2: 128,878,914 (GRCm39) E1004G unknown Het
Xrcc5 G T 1: 72,395,985 (GRCm39) V593L probably benign Het
Zcchc14 A T 8: 122,331,634 (GRCm39) H576Q unknown Het
Zfp616 T A 11: 73,976,271 (GRCm39) C847S probably damaging Het
Zfp626 A T 7: 27,518,924 (GRCm39) Y635F probably benign Het
Zfp799 G A 17: 33,038,473 (GRCm39) R598* probably null Het
Zfp831 A G 2: 174,487,097 (GRCm39) K591E possibly damaging Het
Other mutations in Cep72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Cep72 APN 13 74,210,387 (GRCm39) unclassified probably benign
IGL01373:Cep72 APN 13 74,207,578 (GRCm39) missense probably damaging 1.00
IGL02415:Cep72 APN 13 74,198,273 (GRCm39) missense probably benign 0.31
IGL03372:Cep72 APN 13 74,191,637 (GRCm39) missense possibly damaging 0.47
R0608:Cep72 UTSW 13 74,186,423 (GRCm39) missense probably damaging 1.00
R0884:Cep72 UTSW 13 74,203,000 (GRCm39) critical splice donor site probably null
R2400:Cep72 UTSW 13 74,197,096 (GRCm39) missense probably damaging 0.99
R4906:Cep72 UTSW 13 74,207,584 (GRCm39) missense probably damaging 1.00
R5534:Cep72 UTSW 13 74,210,335 (GRCm39) missense probably benign 0.05
R5567:Cep72 UTSW 13 74,188,260 (GRCm39) missense probably benign 0.00
R5570:Cep72 UTSW 13 74,188,260 (GRCm39) missense probably benign 0.00
R5816:Cep72 UTSW 13 74,197,150 (GRCm39) missense probably benign 0.43
R6310:Cep72 UTSW 13 74,201,144 (GRCm39) missense possibly damaging 0.94
R6513:Cep72 UTSW 13 74,206,582 (GRCm39) missense probably damaging 1.00
R6848:Cep72 UTSW 13 74,186,395 (GRCm39) missense possibly damaging 0.85
R6936:Cep72 UTSW 13 74,188,206 (GRCm39) missense probably damaging 1.00
R7000:Cep72 UTSW 13 74,206,444 (GRCm39) missense probably damaging 0.96
R7006:Cep72 UTSW 13 74,198,427 (GRCm39) nonsense probably null
R7074:Cep72 UTSW 13 74,199,699 (GRCm39) missense probably benign 0.16
R7640:Cep72 UTSW 13 74,206,607 (GRCm39) nonsense probably null
R8260:Cep72 UTSW 13 74,206,465 (GRCm39) missense probably damaging 1.00
R8751:Cep72 UTSW 13 74,198,303 (GRCm39) missense possibly damaging 0.60
R8789:Cep72 UTSW 13 74,186,367 (GRCm39) missense possibly damaging 0.83
R9202:Cep72 UTSW 13 74,198,420 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCAACATTCATTGTGGGGTC -3'
(R):5'- TGCTTCATCTGCTCAGAAATCAAG -3'

Sequencing Primer
(F):5'- AATAAGGCAGGTCTCCAG -3'
(R):5'- AAACAGTAAATCCTTTGCCTGTCC -3'
Posted On 2019-12-20