Incidental Mutation 'R7889:Zfp799'
ID609241
Institutional Source Beutler Lab
Gene Symbol Zfp799
Ensembl Gene ENSMUSG00000095253
Gene Namezinc finger protein 799
Synonyms6030490I01Rik
Accession Numbers

NCBI RefSeq: NM_177359.4; MGI:2443934

Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R7889 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location32815449-32830261 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 32819499 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 598 (R598*)
Ref Sequence ENSEMBL: ENSMUSP00000144480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179695] [ENSMUST00000201499] [ENSMUST00000201876] [ENSMUST00000202759] [ENSMUST00000202988]
Predicted Effect probably null
Transcript: ENSMUST00000179695
AA Change: R597*
SMART Domains Protein: ENSMUSP00000136298
Gene: ENSMUSG00000095253
AA Change: R597*

DomainStartEndE-ValueType
KRAB 3 60 1.22e-9 SMART
low complexity region 97 110 N/A INTRINSIC
ZnF_C2H2 194 216 1.2e-3 SMART
ZnF_C2H2 222 244 1.28e-3 SMART
ZnF_C2H2 250 272 4.87e-4 SMART
ZnF_C2H2 278 300 9.08e-4 SMART
ZnF_C2H2 306 328 2.27e-4 SMART
ZnF_C2H2 334 356 1.53e-1 SMART
ZnF_C2H2 360 382 4.34e-1 SMART
ZnF_C2H2 388 410 1.84e-4 SMART
ZnF_C2H2 416 438 9.58e-3 SMART
ZnF_C2H2 444 466 6.32e-3 SMART
ZnF_C2H2 472 494 2.95e-3 SMART
ZnF_C2H2 500 522 2.2e-2 SMART
ZnF_C2H2 528 550 1.56e-2 SMART
ZnF_C2H2 556 578 2.4e-3 SMART
ZnF_C2H2 584 606 2.53e-2 SMART
ZnF_C2H2 612 634 4.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201499
SMART Domains Protein: ENSMUSP00000143907
Gene: ENSMUSG00000095253

DomainStartEndE-ValueType
KRAB 4 61 1.22e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201876
SMART Domains Protein: ENSMUSP00000144187
Gene: ENSMUSG00000095253

DomainStartEndE-ValueType
KRAB 4 61 5.3e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202759
SMART Domains Protein: ENSMUSP00000144087
Gene: ENSMUSG00000095253

DomainStartEndE-ValueType
KRAB 4 63 5.6e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000202988
AA Change: R598*
SMART Domains Protein: ENSMUSP00000144480
Gene: ENSMUSG00000095253
AA Change: R598*

DomainStartEndE-ValueType
KRAB 4 61 1.22e-9 SMART
low complexity region 98 111 N/A INTRINSIC
ZnF_C2H2 195 217 1.2e-3 SMART
ZnF_C2H2 223 245 1.28e-3 SMART
ZnF_C2H2 251 273 4.87e-4 SMART
ZnF_C2H2 279 301 9.08e-4 SMART
ZnF_C2H2 307 329 2.27e-4 SMART
ZnF_C2H2 335 357 1.53e-1 SMART
ZnF_C2H2 361 383 4.34e-1 SMART
ZnF_C2H2 389 411 1.84e-4 SMART
ZnF_C2H2 417 439 9.58e-3 SMART
ZnF_C2H2 445 467 6.32e-3 SMART
ZnF_C2H2 473 495 2.95e-3 SMART
ZnF_C2H2 501 523 2.2e-2 SMART
ZnF_C2H2 529 551 1.56e-2 SMART
ZnF_C2H2 557 579 2.4e-3 SMART
ZnF_C2H2 585 607 2.53e-2 SMART
ZnF_C2H2 613 635 4.47e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl3 C T 4: 99,031,071 L23F probably benign Het
Art2a-ps C T 7: 101,555,211 S40N not run Het
Ash1l A G 3: 88,966,038 T43A probably benign Het
Azi2 A G 9: 118,061,915 E336G probably benign Het
Cap2 A G 13: 46,646,575 H419R probably damaging Het
Ccdc14 T A 16: 34,723,836 S903T probably damaging Het
Cep72 A T 13: 74,050,122 S380T possibly damaging Het
Clca3a2 C A 3: 144,810,813 E341* probably null Het
Clcnkb T G 4: 141,410,604 I294L probably benign Het
Cyp2d9 T A 15: 82,455,826 M350K probably damaging Het
Dhx40 T G 11: 86,798,967 I266L probably benign Het
Dnah5 G T 15: 28,448,414 E4208* probably null Het
Ephb2 T C 4: 136,771,042 N242S probably damaging Het
Fam13b A T 18: 34,457,691 F478Y probably benign Het
Fbxo40 T A 16: 36,969,650 D366V probably damaging Het
Fhod3 A T 18: 24,770,494 K95M probably damaging Het
Foxo3 T A 10: 42,275,027 Q136L probably benign Het
Gadl1 A T 9: 115,954,815 Q236L possibly damaging Het
Galnt13 A G 2: 55,112,861 D560G probably benign Het
Ghsr A G 3: 27,372,166 S124G probably benign Het
Glyctk T A 9: 106,156,439 R68W unknown Het
Gm10031 G A 1: 156,525,395 A389T probably benign Het
Gm14025 T C 2: 129,036,994 E1004G unknown Het
Gm5157 G A 7: 21,184,716 P301S unknown Het
Hdc A T 2: 126,616,210 I64N probably damaging Het
Ighv1-43 T C 12: 114,945,963 Y113C probably damaging Het
Ipo9 T C 1: 135,406,853 T273A probably benign Het
Itga4 G A 2: 79,316,045 V774I probably benign Het
Itpr3 T C 17: 27,116,777 L2287P probably damaging Het
Llgl1 T A 11: 60,707,312 I394N probably damaging Het
Mta1 G A 12: 113,131,688 R487H probably benign Het
Neb T C 2: 52,147,669 D7049G probably benign Het
Nlrp4f G A 13: 65,195,018 S271F probably damaging Het
Noxo1 A G 17: 24,699,382 D172G probably damaging Het
Nup155 T A 15: 8,121,507 V347E probably damaging Het
Oaf G T 9: 43,222,671 A251E possibly damaging Het
Pds5b T A 5: 150,792,172 F1039I probably damaging Het
Prmt3 A G 7: 49,787,301 D208G possibly damaging Het
Ptcd3 G A 6: 71,888,608 T441M probably damaging Het
Rabl6 A G 2: 25,584,774 probably null Het
Shtn1 T A 19: 59,003,896 I417F probably damaging Het
Slc20a2 T C 8: 22,540,401 S158P probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Spata5 A G 3: 37,578,810 D855G probably benign Het
Spef2 T C 15: 9,717,563 Y232C probably damaging Het
Stard9 C T 2: 120,704,461 T3733I probably benign Het
Thrap3 A T 4: 126,178,062 F512L probably benign Het
Tmem150c A T 5: 100,093,104 I30K probably damaging Het
Tnnt1 C T 7: 4,508,583 A168T probably damaging Het
Trak2 A G 1: 58,918,824 L308P probably damaging Het
Trp53i11 T C 2: 93,198,899 L81P probably damaging Het
Usp16 T C 16: 87,474,584 Y344H probably benign Het
Wdr60 T A 12: 116,255,939 K128* probably null Het
Xrcc5 G T 1: 72,356,826 V593L probably benign Het
Zcchc14 A T 8: 121,604,895 H576Q unknown Het
Zfp616 T A 11: 74,085,445 C847S probably damaging Het
Zfp626 A T 7: 27,819,499 Y635F probably benign Het
Zfp831 A G 2: 174,645,304 K591E possibly damaging Het
Other mutations in Zfp799
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01667:Zfp799 APN 17 32821820 missense possibly damaging 0.73
P0016:Zfp799 UTSW 17 32819357 missense possibly damaging 0.79
R0116:Zfp799 UTSW 17 32821035 missense possibly damaging 0.96
R0326:Zfp799 UTSW 17 32820726 missense possibly damaging 0.73
R1487:Zfp799 UTSW 17 32820677 missense possibly damaging 0.85
R1863:Zfp799 UTSW 17 32819400 missense probably damaging 1.00
R1929:Zfp799 UTSW 17 32821803 missense probably damaging 1.00
R1983:Zfp799 UTSW 17 32822110 missense probably damaging 1.00
R2127:Zfp799 UTSW 17 32819498 missense possibly damaging 0.80
R2271:Zfp799 UTSW 17 32821803 missense probably damaging 1.00
R2697:Zfp799 UTSW 17 32820240 nonsense probably null
R5134:Zfp799 UTSW 17 32820441 missense probably damaging 1.00
R5613:Zfp799 UTSW 17 32819990 missense probably damaging 0.98
R5839:Zfp799 UTSW 17 32822112 missense probably null 0.99
R6389:Zfp799 UTSW 17 32820578 missense probably damaging 1.00
R6414:Zfp799 UTSW 17 32820285 missense probably damaging 1.00
R6475:Zfp799 UTSW 17 32820846 missense probably damaging 0.99
R6593:Zfp799 UTSW 17 32819790 missense probably damaging 1.00
R7133:Zfp799 UTSW 17 32820236 missense probably benign 0.19
R7543:Zfp799 UTSW 17 32820560 missense probably benign 0.11
R7883:Zfp799 UTSW 17 32820282 missense probably damaging 1.00
R7966:Zfp799 UTSW 17 32820282 missense probably damaging 1.00
R7972:Zfp799 UTSW 17 32819499 nonsense probably null
Z1176:Zfp799 UTSW 17 32820216 nonsense probably null
Z1177:Zfp799 UTSW 17 32830219 start gained probably benign
Z1177:Zfp799 UTSW 17 32830221 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CGCAGTCTTACGGGTGTT -3'
(R):5'- GTCACAGCTCCGTTAAGTACC -3'

Sequencing Primer
(F):5'- CAGTCTTACGGGTGTTACGAC -3'
(R):5'- TACCACGAGTTGATTCATACCGGG -3'
Posted On2019-12-20