Incidental Mutation 'R7890:Aasdh'
ID609255
Institutional Source Beutler Lab
Gene Symbol Aasdh
Ensembl Gene ENSMUSG00000055923
Gene Nameaminoadipate-semialdehyde dehydrogenase
SynonymsA230062G08Rik
MMRRC Submission
Accession Numbers

Genbank: NM_173765.3; Ensembl: ENSMUST00000120963

Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R7890 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location76873659-76905514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76884122 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 551 (K551N)
Ref Sequence ENSEMBL: ENSMUSP00000113792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069709] [ENSMUST00000120963] [ENSMUST00000123682] [ENSMUST00000126741] [ENSMUST00000146570] [ENSMUST00000149602]
Predicted Effect probably benign
Transcript: ENSMUST00000069709
AA Change: K551N

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000069279
Gene: ENSMUSG00000055923
AA Change: K551N

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000120963
AA Change: K551N

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113792
Gene: ENSMUSG00000055923
AA Change: K551N

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123682
SMART Domains Protein: ENSMUSP00000121050
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 231 1.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126741
SMART Domains Protein: ENSMUSP00000118854
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 403 7.5e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146570
AA Change: K551N

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000117639
Gene: ENSMUSG00000055923
AA Change: K551N

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 2.1e-58 PFAM
Pfam:PP-binding 556 628 1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149602
SMART Domains Protein: ENSMUSP00000117489
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
PQQ 21 53 4.37e-2 SMART
PQQ 63 95 2.3e1 SMART
Blast:PQQ 104 130 2e-6 BLAST
PQQ 141 173 2.61e2 SMART
low complexity region 191 200 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: The gene product is a cytosolic enzyme involved in the production of alpha-aminoadipic acid from alpha-aminoadipic semialdehyde. It is postulated that this enzyme plays a role in lysine metabolism. There is currently debate regarding this enzyme's putative requirement of pyrroloquinoline quinine as an essential cofactor. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Jan 2010]
Allele List at MGI

All alleles(14) : Gene trapped(14)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp4 A C 7: 44,254,104 L262R probably damaging Het
Acsf3 G T 8: 122,785,965 probably null Het
Ago4 T C 4: 126,526,076 Q36R probably benign Het
Ankrd31 T A 13: 96,831,871 I672K probably benign Het
Astn1 A T 1: 158,580,333 D628V probably damaging Het
Brca2 T C 5: 150,539,381 V870A possibly damaging Het
Camk4 T C 18: 33,185,005 V405A probably benign Het
Carmil1 A T 13: 24,013,232 S146T Het
Cflar T A 1: 58,752,756 L406Q Het
Clic6 T A 16: 92,499,387 S312T probably benign Het
Col5a2 T C 1: 45,404,987 probably null Het
Ctc1 C A 11: 69,026,529 Q384K probably damaging Het
Defa24 A G 8: 21,734,540 K2E probably damaging Het
Dis3l C A 9: 64,322,471 A309S probably benign Het
Dnah9 A G 11: 66,072,072 S1806P probably damaging Het
Dolk C T 2: 30,284,714 V440I probably damaging Het
Erc2 A G 14: 28,040,341 probably null Het
Fntb T C 12: 76,873,450 probably null Het
Gm12569 C T 11: 51,234,838 S196L probably damaging Het
Gm4846 A T 1: 166,494,659 V113E probably benign Het
Gm5592 G T 7: 41,286,759 Q228H probably damaging Het
Gm5916 T A 9: 36,120,995 T48S possibly damaging Het
Ift172 G T 5: 31,283,081 Y287* probably null Het
Il27ra T C 8: 84,033,985 I450M probably damaging Het
Krtap31-2 T A 11: 99,936,551 C70S possibly damaging Het
Lipo4 T A 19: 33,501,564 H292L probably damaging Het
Lyst T C 13: 13,740,569 F3283L probably damaging Het
Mctp1 T G 13: 76,827,757 C750G probably damaging Het
Mtmr7 T C 8: 40,551,735 D600G possibly damaging Het
Mylk C T 16: 34,963,648 Q1395* probably null Het
Nap1l5 T A 6: 58,906,888 D27V probably damaging Het
Nfkbib T C 7: 28,762,087 D75G probably damaging Het
Nlrc4 T A 17: 74,437,508 M793L probably benign Het
Olfr451-ps1 T A 6: 42,801,492 C250* probably null Het
Olfr472 T C 7: 107,903,043 S109P probably benign Het
Olfr599 G T 7: 103,338,330 C92F probably benign Het
Olfr832 T C 9: 18,945,503 M285T probably benign Het
Olfr970 C T 9: 39,820,014 A125V probably damaging Het
Pcdh15 G A 10: 74,642,314 R207Q probably damaging Het
Plek T C 11: 16,995,238 T54A probably benign Het
Pno1 C A 11: 17,211,443 R22L probably benign Het
Prkca A T 11: 108,012,684 N287K probably damaging Het
Rapgef6 C G 11: 54,626,723 H414D probably damaging Het
Rpa1 CA C 11: 75,307,224 probably null Het
Rpap2 T C 5: 107,606,911 C136R probably damaging Het
Rtl1 C T 12: 109,592,817 E863K possibly damaging Het
Ryr3 A T 2: 112,926,912 I366N probably damaging Het
Scn9a T C 2: 66,543,112 I508V probably benign Het
Sec14l3 A G 11: 4,074,795 D248G probably damaging Het
Six6 A T 12: 72,940,543 Q163L probably benign Het
Slco6c1 A G 1: 97,062,467 V683A possibly damaging Het
Smc1b A G 15: 85,066,328 V1165A probably damaging Het
Smgc A T 15: 91,847,076 Q241L possibly damaging Het
Tdrp A T 8: 13,955,727 S65T probably damaging Het
Tg A T 15: 66,683,814 Y785F probably damaging Het
Themis2 T G 4: 132,789,643 Q182P probably damaging Het
Tmem86b G T 7: 4,628,405 S216* probably null Het
Ttyh2 T A 11: 114,686,446 I61N possibly damaging Het
Vmn2r97 A T 17: 18,929,540 T397S probably benign Het
Zfp141 C T 7: 42,476,479 D190N probably damaging Het
Zfp58 T C 13: 67,491,995 R126G possibly damaging Het
Other mutations in Aasdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Aasdh APN 5 76878534 unclassified probably benign
IGL01013:Aasdh APN 5 76886206 missense possibly damaging 0.68
IGL01558:Aasdh APN 5 76888617 missense possibly damaging 0.89
IGL02544:Aasdh APN 5 76902114 missense probably benign 0.27
IGL02614:Aasdh APN 5 76896368 splice site probably benign
IGL02678:Aasdh APN 5 76888020 splice site probably benign
IGL02739:Aasdh APN 5 76878517 missense possibly damaging 0.64
IGL02947:Aasdh APN 5 76902110 missense probably benign 0.01
IGL03116:Aasdh APN 5 76902089 splice site probably null
IGL03398:Aasdh APN 5 76891719 missense probably benign 0.02
1mM(1):Aasdh UTSW 5 76896617 missense possibly damaging 0.91
R0183:Aasdh UTSW 5 76886235 missense probably benign 0.05
R0226:Aasdh UTSW 5 76902002 missense probably damaging 1.00
R0367:Aasdh UTSW 5 76902114 missense probably damaging 0.99
R0386:Aasdh UTSW 5 76896461 missense probably damaging 0.98
R0529:Aasdh UTSW 5 76876267 nonsense probably null
R0881:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R0882:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1033:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1034:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1035:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1036:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1366:Aasdh UTSW 5 76888804 missense probably benign 0.10
R1446:Aasdh UTSW 5 76886289 missense probably benign 0.45
R1449:Aasdh UTSW 5 76886289 missense probably benign 0.45
R1469:Aasdh UTSW 5 76891679 missense probably damaging 0.97
R1469:Aasdh UTSW 5 76891679 missense probably damaging 0.97
R1583:Aasdh UTSW 5 76882681 missense probably benign 0.00
R1641:Aasdh UTSW 5 76891779 missense probably benign 0.36
R1876:Aasdh UTSW 5 76877549 missense probably damaging 1.00
R1895:Aasdh UTSW 5 76891704 missense probably damaging 1.00
R1946:Aasdh UTSW 5 76891704 missense probably damaging 1.00
R3615:Aasdh UTSW 5 76888782 missense probably benign 0.20
R3616:Aasdh UTSW 5 76888782 missense probably benign 0.20
R3746:Aasdh UTSW 5 76888654 nonsense probably null
R3747:Aasdh UTSW 5 76888654 nonsense probably null
R3748:Aasdh UTSW 5 76888654 nonsense probably null
R3750:Aasdh UTSW 5 76888654 nonsense probably null
R3836:Aasdh UTSW 5 76878468 missense probably benign 0.32
R4857:Aasdh UTSW 5 76887284 missense probably benign 0.01
R4928:Aasdh UTSW 5 76896688 missense possibly damaging 0.65
R4937:Aasdh UTSW 5 76888654 nonsense probably null
R5762:Aasdh UTSW 5 76896598 missense probably benign 0.00
R5866:Aasdh UTSW 5 76876211 missense probably damaging 1.00
R5940:Aasdh UTSW 5 76882898 missense probably benign 0.07
R6253:Aasdh UTSW 5 76886258 missense possibly damaging 0.81
R6542:Aasdh UTSW 5 76883055 missense probably damaging 1.00
R6825:Aasdh UTSW 5 76888849 splice site probably null
R6868:Aasdh UTSW 5 76891680 missense probably damaging 0.99
R6876:Aasdh UTSW 5 76896441 missense probably damaging 1.00
R6961:Aasdh UTSW 5 76876301 missense probably damaging 1.00
R6963:Aasdh UTSW 5 76896456 missense probably damaging 0.99
R7069:Aasdh UTSW 5 76876356 missense probably benign 0.03
R7220:Aasdh UTSW 5 76901925 missense probably benign 0.13
R7545:Aasdh UTSW 5 76880014 missense probably damaging 1.00
R7673:Aasdh UTSW 5 76882708 missense probably benign 0.03
R7703:Aasdh UTSW 5 76888077 missense probably damaging 0.99
R7978:Aasdh UTSW 5 76888668 missense probably damaging 0.99
R8046:Aasdh UTSW 5 76896478 missense probably benign
R8152:Aasdh UTSW 5 76896458 missense probably damaging 1.00
Z1088:Aasdh UTSW 5 76901157 splice site probably null
Z1176:Aasdh UTSW 5 76891796 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATTAAGGGAGGTATGCTAATTGGC -3'
(R):5'- CTGGGGCTAAATGGACTCAG -3'

Sequencing Primer
(F):5'- TGCTAATTGGCATATACAATAACAGC -3'
(R):5'- GTGAGTCACCTAGGATCTTGTACAC -3'
Posted On2019-12-20