Incidental Mutation 'R7890:Or52ab4'
ID 609265
Institutional Source Beutler Lab
Gene Symbol Or52ab4
Ensembl Gene ENSMUSG00000073950
Gene Name olfactory receptor family 52 subfamily AB member 4
Synonyms Olfr599, MOR23-1, GA_x6K02T2PBJ9-6047402-6048349
MMRRC Submission 045942-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R7890 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 102987219-102988268 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 102987537 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 92 (C92F)
Ref Sequence ENSEMBL: ENSMUSP00000149281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098201] [ENSMUST00000214329]
AlphaFold Q8VG01
Predicted Effect probably benign
Transcript: ENSMUST00000098201
AA Change: C92F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095803
Gene: ENSMUSG00000073950
AA Change: C92F

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 1.8e-94 PFAM
Pfam:7TM_GPCR_Srsx 37 308 1.2e-6 PFAM
Pfam:7tm_1 43 293 2.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214329
AA Change: C92F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh T A 5: 77,031,969 (GRCm39) K551N probably benign Het
Acp4 A C 7: 43,903,528 (GRCm39) L262R probably damaging Het
Acsf3 G T 8: 123,512,704 (GRCm39) probably null Het
Ago4 T C 4: 126,419,869 (GRCm39) Q36R probably benign Het
Ankrd31 T A 13: 96,968,379 (GRCm39) I672K probably benign Het
Astn1 A T 1: 158,407,903 (GRCm39) D628V probably damaging Het
Brca2 T C 5: 150,462,846 (GRCm39) V870A possibly damaging Het
Camk4 T C 18: 33,318,058 (GRCm39) V405A probably benign Het
Carmil1 A T 13: 24,197,215 (GRCm39) S146T Het
Cflar T A 1: 58,791,915 (GRCm39) L406Q Het
Clic6 T A 16: 92,296,275 (GRCm39) S312T probably benign Het
Col5a2 T C 1: 45,444,147 (GRCm39) probably null Het
Ctc1 C A 11: 68,917,355 (GRCm39) Q384K probably damaging Het
Defa24 A G 8: 22,224,556 (GRCm39) K2E probably damaging Het
Dis3l C A 9: 64,229,753 (GRCm39) A309S probably benign Het
Dnah9 A G 11: 65,962,898 (GRCm39) S1806P probably damaging Het
Dolk C T 2: 30,174,726 (GRCm39) V440I probably damaging Het
Erc2 A G 14: 27,762,298 (GRCm39) probably null Het
Fntb T C 12: 76,920,224 (GRCm39) probably null Het
Gm4846 A T 1: 166,322,228 (GRCm39) V113E probably benign Het
Gm5592 G T 7: 40,936,183 (GRCm39) Q228H probably damaging Het
Gm5916 T A 9: 36,032,291 (GRCm39) T48S possibly damaging Het
Ift172 G T 5: 31,440,425 (GRCm39) Y287* probably null Het
Il27ra T C 8: 84,760,614 (GRCm39) I450M probably damaging Het
Krtap31-2 T A 11: 99,827,377 (GRCm39) C70S possibly damaging Het
Lipo4 T A 19: 33,478,964 (GRCm39) H292L probably damaging Het
Lyst T C 13: 13,915,154 (GRCm39) F3283L probably damaging Het
Mctp1 T G 13: 76,975,876 (GRCm39) C750G probably damaging Het
Msantd5 C T 11: 51,125,665 (GRCm39) S196L probably damaging Het
Mtmr7 T C 8: 41,004,776 (GRCm39) D600G possibly damaging Het
Mylk C T 16: 34,784,018 (GRCm39) Q1395* probably null Het
Nap1l5 T A 6: 58,883,873 (GRCm39) D27V probably damaging Het
Nfkbib T C 7: 28,461,512 (GRCm39) D75G probably damaging Het
Nlrc4 T A 17: 74,744,503 (GRCm39) M793L probably benign Het
Or13m2-ps1 T A 6: 42,778,426 (GRCm39) C250* probably null Het
Or5p52 T C 7: 107,502,250 (GRCm39) S109P probably benign Het
Or7g19 T C 9: 18,856,799 (GRCm39) M285T probably benign Het
Or8g37 C T 9: 39,731,310 (GRCm39) A125V probably damaging Het
Pcdh15 G A 10: 74,478,146 (GRCm39) R207Q probably damaging Het
Plek T C 11: 16,945,238 (GRCm39) T54A probably benign Het
Pno1 C A 11: 17,161,443 (GRCm39) R22L probably benign Het
Prkca A T 11: 107,903,510 (GRCm39) N287K probably damaging Het
Rapgef6 C G 11: 54,517,549 (GRCm39) H414D probably damaging Het
Rpa1 CA C 11: 75,198,050 (GRCm39) probably null Het
Rpap2 T C 5: 107,754,777 (GRCm39) C136R probably damaging Het
Rtl1 C T 12: 109,559,251 (GRCm39) E863K possibly damaging Het
Ryr3 A T 2: 112,757,257 (GRCm39) I366N probably damaging Het
Scn9a T C 2: 66,373,456 (GRCm39) I508V probably benign Het
Sec14l3 A G 11: 4,024,795 (GRCm39) D248G probably damaging Het
Six6 A T 12: 72,987,317 (GRCm39) Q163L probably benign Het
Slco6c1 A G 1: 96,990,192 (GRCm39) V683A possibly damaging Het
Smc1b A G 15: 84,950,529 (GRCm39) V1165A probably damaging Het
Smgc A T 15: 91,731,279 (GRCm39) Q241L possibly damaging Het
Tdrp A T 8: 14,005,727 (GRCm39) S65T probably damaging Het
Tg A T 15: 66,555,663 (GRCm39) Y785F probably damaging Het
Themis2 T G 4: 132,516,954 (GRCm39) Q182P probably damaging Het
Tmem86b G T 7: 4,631,404 (GRCm39) S216* probably null Het
Ttyh2 T A 11: 114,577,272 (GRCm39) I61N possibly damaging Het
Vmn2r97 A T 17: 19,149,802 (GRCm39) T397S probably benign Het
Zfp141 C T 7: 42,125,903 (GRCm39) D190N probably damaging Het
Zfp58 T C 13: 67,640,114 (GRCm39) R126G possibly damaging Het
Other mutations in Or52ab4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Or52ab4 APN 7 102,987,974 (GRCm39) nonsense probably null
IGL01744:Or52ab4 APN 7 102,987,435 (GRCm39) missense probably damaging 0.98
IGL02011:Or52ab4 APN 7 102,988,056 (GRCm39) missense probably damaging 0.98
IGL02328:Or52ab4 APN 7 102,987,497 (GRCm39) missense probably damaging 1.00
IGL02630:Or52ab4 APN 7 102,987,636 (GRCm39) missense probably damaging 1.00
IGL03119:Or52ab4 APN 7 102,987,929 (GRCm39) missense probably damaging 1.00
PIT4468001:Or52ab4 UTSW 7 102,987,807 (GRCm39) missense probably damaging 1.00
R0599:Or52ab4 UTSW 7 102,987,393 (GRCm39) missense probably damaging 1.00
R4084:Or52ab4 UTSW 7 102,987,527 (GRCm39) missense probably damaging 0.99
R5068:Or52ab4 UTSW 7 102,987,229 (GRCm39) start gained probably null
R5069:Or52ab4 UTSW 7 102,987,229 (GRCm39) start gained probably null
R5280:Or52ab4 UTSW 7 102,987,708 (GRCm39) missense probably benign
R5816:Or52ab4 UTSW 7 102,988,202 (GRCm39) missense probably benign 0.00
R6560:Or52ab4 UTSW 7 102,987,945 (GRCm39) missense probably benign 0.02
R7001:Or52ab4 UTSW 7 102,987,428 (GRCm39) missense possibly damaging 0.51
R8295:Or52ab4 UTSW 7 102,987,474 (GRCm39) missense probably benign 0.08
R8430:Or52ab4 UTSW 7 102,988,164 (GRCm39) missense probably benign 0.01
R8946:Or52ab4 UTSW 7 102,987,573 (GRCm39) missense probably damaging 1.00
R9045:Or52ab4 UTSW 7 102,987,903 (GRCm39) missense probably damaging 0.99
R9402:Or52ab4 UTSW 7 102,988,196 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGATTCTGATTGGCATCCCTG -3'
(R):5'- TTGCCCGAATTGCAACCAC -3'

Sequencing Primer
(F):5'- CTGATTGGCATCCCTGGACTG -3'
(R):5'- GAATTGCAACCACCAGAACG -3'
Posted On 2019-12-20