Incidental Mutation 'R7890:Rpa1'
ID 609284
Institutional Source Beutler Lab
Gene Symbol Rpa1
Ensembl Gene ENSMUSG00000000751
Gene Name replication protein A1
Synonyms Rpa, 5031405K23Rik, RP-A, RF-A, 70kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7890 (G1)
Quality Score 217.468
Status Validated
Chromosome 11
Chromosomal Location 75298166-75348324 bp(-) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) CA to C at 75307224 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000000767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000767] [ENSMUST00000092907]
AlphaFold Q8VEE4
Predicted Effect probably null
Transcript: ENSMUST00000000767
SMART Domains Protein: ENSMUSP00000000767
Gene: ENSMUSG00000000751

DomainStartEndE-ValueType
Pfam:Rep-A_N 5 93 7.2e-30 PFAM
low complexity region 145 175 N/A INTRINSIC
Pfam:tRNA_anti-codon 227 316 5e-13 PFAM
Pfam:REPA_OB_2 335 432 5e-37 PFAM
Pfam:Rep_fac-A_C 491 636 4.5e-57 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000092907
SMART Domains Protein: ENSMUSP00000090585
Gene: ENSMUSG00000000751

DomainStartEndE-ValueType
Pfam:Rep-A_N 5 104 4.3e-35 PFAM
low complexity region 124 154 N/A INTRINSIC
Pfam:tRNA_anti-codon 206 295 8.4e-13 PFAM
SCOP:d1fgua2 308 435 8e-46 SMART
Pfam:Rep_fac-A_C 470 615 9.2e-56 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality before implantation and impaired cell proliferation. Heterozygous null mice display decreased survival, chromosomal instability, impaired double strand break repair, and develop lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh T A 5: 76,884,122 K551N probably benign Het
Acp4 A C 7: 44,254,104 L262R probably damaging Het
Acsf3 G T 8: 122,785,965 probably null Het
Ago4 T C 4: 126,526,076 Q36R probably benign Het
Ankrd31 T A 13: 96,831,871 I672K probably benign Het
Astn1 A T 1: 158,580,333 D628V probably damaging Het
Brca2 T C 5: 150,539,381 V870A possibly damaging Het
Camk4 T C 18: 33,185,005 V405A probably benign Het
Carmil1 A T 13: 24,013,232 S146T Het
Cflar T A 1: 58,752,756 L406Q Het
Clic6 T A 16: 92,499,387 S312T probably benign Het
Col5a2 T C 1: 45,404,987 probably null Het
Ctc1 C A 11: 69,026,529 Q384K probably damaging Het
Defa24 A G 8: 21,734,540 K2E probably damaging Het
Dis3l C A 9: 64,322,471 A309S probably benign Het
Dnah9 A G 11: 66,072,072 S1806P probably damaging Het
Dolk C T 2: 30,284,714 V440I probably damaging Het
Erc2 A G 14: 28,040,341 probably null Het
Fntb T C 12: 76,873,450 probably null Het
Gm12569 C T 11: 51,234,838 S196L probably damaging Het
Gm4846 A T 1: 166,494,659 V113E probably benign Het
Gm5592 G T 7: 41,286,759 Q228H probably damaging Het
Gm5916 T A 9: 36,120,995 T48S possibly damaging Het
Ift172 G T 5: 31,283,081 Y287* probably null Het
Il27ra T C 8: 84,033,985 I450M probably damaging Het
Krtap31-2 T A 11: 99,936,551 C70S possibly damaging Het
Lipo4 T A 19: 33,501,564 H292L probably damaging Het
Lyst T C 13: 13,740,569 F3283L probably damaging Het
Mctp1 T G 13: 76,827,757 C750G probably damaging Het
Mtmr7 T C 8: 40,551,735 D600G possibly damaging Het
Mylk C T 16: 34,963,648 Q1395* probably null Het
Nap1l5 T A 6: 58,906,888 D27V probably damaging Het
Nfkbib T C 7: 28,762,087 D75G probably damaging Het
Nlrc4 T A 17: 74,437,508 M793L probably benign Het
Olfr451-ps1 T A 6: 42,801,492 C250* probably null Het
Olfr472 T C 7: 107,903,043 S109P probably benign Het
Olfr599 G T 7: 103,338,330 C92F probably benign Het
Olfr832 T C 9: 18,945,503 M285T probably benign Het
Olfr970 C T 9: 39,820,014 A125V probably damaging Het
Pcdh15 G A 10: 74,642,314 R207Q probably damaging Het
Plek T C 11: 16,995,238 T54A probably benign Het
Pno1 C A 11: 17,211,443 R22L probably benign Het
Prkca A T 11: 108,012,684 N287K probably damaging Het
Rapgef6 C G 11: 54,626,723 H414D probably damaging Het
Rpap2 T C 5: 107,606,911 C136R probably damaging Het
Rtl1 C T 12: 109,592,817 E863K possibly damaging Het
Ryr3 A T 2: 112,926,912 I366N probably damaging Het
Scn9a T C 2: 66,543,112 I508V probably benign Het
Sec14l3 A G 11: 4,074,795 D248G probably damaging Het
Six6 A T 12: 72,940,543 Q163L probably benign Het
Slco6c1 A G 1: 97,062,467 V683A possibly damaging Het
Smc1b A G 15: 85,066,328 V1165A probably damaging Het
Smgc A T 15: 91,847,076 Q241L possibly damaging Het
Tdrp A T 8: 13,955,727 S65T probably damaging Het
Tg A T 15: 66,683,814 Y785F probably damaging Het
Themis2 T G 4: 132,789,643 Q182P probably damaging Het
Tmem86b G T 7: 4,628,405 S216* probably null Het
Ttyh2 T A 11: 114,686,446 I61N possibly damaging Het
Vmn2r97 A T 17: 18,929,540 T397S probably benign Het
Zfp141 C T 7: 42,476,479 D190N probably damaging Het
Zfp58 T C 13: 67,491,995 R126G possibly damaging Het
Other mutations in Rpa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Rpa1 APN 11 75312315 missense probably damaging 1.00
IGL01347:Rpa1 APN 11 75307285 missense probably damaging 1.00
IGL02976:Rpa1 APN 11 75312802 missense probably damaging 0.99
IGL03169:Rpa1 APN 11 75301357 missense probably damaging 0.97
nonnae UTSW 11 75314895 missense probably damaging 1.00
R6762_Rpa1_753 UTSW 11 75340345 missense possibly damaging 0.89
FR4976:Rpa1 UTSW 11 75318519 small deletion probably benign
PIT4576001:Rpa1 UTSW 11 75313158 missense probably damaging 1.00
R0017:Rpa1 UTSW 11 75314861 missense probably null 1.00
R0017:Rpa1 UTSW 11 75314861 missense probably null 1.00
R0126:Rpa1 UTSW 11 75318529 missense probably benign 0.00
R0240:Rpa1 UTSW 11 75328687 missense probably benign 0.01
R0240:Rpa1 UTSW 11 75328687 missense probably benign 0.01
R0465:Rpa1 UTSW 11 75313095 missense probably damaging 0.99
R0718:Rpa1 UTSW 11 75318401 splice site probably benign
R0973:Rpa1 UTSW 11 75312973 splice site probably null
R1055:Rpa1 UTSW 11 75302732 missense probably damaging 1.00
R1172:Rpa1 UTSW 11 75312393 missense probably damaging 1.00
R1642:Rpa1 UTSW 11 75312691 critical splice donor site probably null
R1883:Rpa1 UTSW 11 75318483 missense probably benign
R1975:Rpa1 UTSW 11 75306176 missense probably damaging 1.00
R5008:Rpa1 UTSW 11 75313299 critical splice donor site probably null
R5279:Rpa1 UTSW 11 75313344 missense probably damaging 0.96
R6083:Rpa1 UTSW 11 75314911 missense probably damaging 1.00
R6161:Rpa1 UTSW 11 75314895 missense probably damaging 1.00
R6187:Rpa1 UTSW 11 75310236 missense probably benign 0.00
R6762:Rpa1 UTSW 11 75340345 missense possibly damaging 0.89
R6828:Rpa1 UTSW 11 75314871 missense probably damaging 1.00
R7044:Rpa1 UTSW 11 75312802 missense probably damaging 0.99
R7331:Rpa1 UTSW 11 75313115 missense probably damaging 0.98
R7798:Rpa1 UTSW 11 75312809 missense probably damaging 0.96
R7938:Rpa1 UTSW 11 75307224 frame shift probably null
R8116:Rpa1 UTSW 11 75302675 missense possibly damaging 0.90
R8258:Rpa1 UTSW 11 75302724 missense probably benign 0.03
R8259:Rpa1 UTSW 11 75302724 missense probably benign 0.03
R8837:Rpa1 UTSW 11 75313341 missense possibly damaging 0.70
R9169:Rpa1 UTSW 11 75310173 nonsense probably null
RF018:Rpa1 UTSW 11 75318517 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAGCCCAGGCCTATCTGATTTC -3'
(R):5'- TTCTGCATATCGCTCGTGAG -3'

Sequencing Primer
(F):5'- GATTTCCTCAGCACACCCC -3'
(R):5'- GCGTGGGAGCTAGGATGTACAC -3'
Posted On 2019-12-20