Incidental Mutation 'R7890:Carmil1'
ID609292
Institutional Source Beutler Lab
Gene Symbol Carmil1
Ensembl Gene ENSMUSG00000021338
Gene Namecapping protein regulator and myosin 1 linker 1
Synonyms1110037D04Rik, Lrrc16, Lrrc16a, Carmil
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7890 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location24012344-24280795 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24013232 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 146 (S146T)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072889] [ENSMUST00000110398] [ENSMUST00000125901]
Predicted Effect probably benign
Transcript: ENSMUST00000072889
SMART Domains Protein: ENSMUSP00000072662
Gene: ENSMUSG00000021338

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
LRR 245 272 2.42e1 SMART
LRR 275 302 1.04e1 SMART
LRR 304 331 3.1e0 SMART
LRR 336 363 5.66e1 SMART
Blast:LRR 423 450 9e-8 BLAST
Blast:LRR 451 484 7e-9 BLAST
LRR 574 601 8.81e-2 SMART
Blast:LRR 602 629 6e-10 BLAST
low complexity region 745 758 N/A INTRINSIC
Pfam:CARMIL_C 790 1083 1.1e-101 PFAM
low complexity region 1131 1147 N/A INTRINSIC
low complexity region 1245 1251 N/A INTRINSIC
low complexity region 1253 1268 N/A INTRINSIC
low complexity region 1287 1296 N/A INTRINSIC
low complexity region 1317 1332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110398
SMART Domains Protein: ENSMUSP00000106028
Gene: ENSMUSG00000021338

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
LRR 245 272 2.42e1 SMART
LRR 275 302 1.04e1 SMART
LRR 304 331 3.1e0 SMART
LRR 336 363 5.66e1 SMART
Blast:LRR 423 450 9e-8 BLAST
LRR 451 480 3.15e1 SMART
Pfam:LRR_6 481 507 1.9e-2 PFAM
LRR 570 597 8.81e-2 SMART
Blast:LRR 598 625 6e-10 BLAST
low complexity region 741 754 N/A INTRINSIC
low complexity region 879 888 N/A INTRINSIC
PDB:3LK3|T 964 1076 1e-56 PDB
low complexity region 1127 1143 N/A INTRINSIC
low complexity region 1241 1247 N/A INTRINSIC
low complexity region 1249 1264 N/A INTRINSIC
low complexity region 1283 1292 N/A INTRINSIC
low complexity region 1313 1325 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125901
SMART Domains Protein: ENSMUSP00000126522
Gene: ENSMUSG00000021338

DomainStartEndE-ValueType
Blast:LRR 13 40 5e-8 BLAST
Blast:LRR 41 74 4e-9 BLAST
Pfam:LRR_6 75 101 4.4e-2 PFAM
Pfam:LRR_6 164 187 1.6e-3 PFAM
Blast:LRR 192 219 7e-10 BLAST
low complexity region 335 348 N/A INTRINSIC
low complexity region 473 482 N/A INTRINSIC
PDB:3LK3|T 564 676 4e-57 PDB
low complexity region 727 743 N/A INTRINSIC
low complexity region 841 847 N/A INTRINSIC
low complexity region 849 864 N/A INTRINSIC
low complexity region 883 892 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000120971
Gene: ENSMUSG00000021338
AA Change: S146T

DomainStartEndE-ValueType
transmembrane domain 138 160 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh T A 5: 76,884,122 K551N probably benign Het
Acp4 A C 7: 44,254,104 L262R probably damaging Het
Acsf3 G T 8: 122,785,965 probably null Het
Ago4 T C 4: 126,526,076 Q36R probably benign Het
Ankrd31 T A 13: 96,831,871 I672K probably benign Het
Astn1 A T 1: 158,580,333 D628V probably damaging Het
Brca2 T C 5: 150,539,381 V870A possibly damaging Het
Camk4 T C 18: 33,185,005 V405A probably benign Het
Cflar T A 1: 58,752,756 L406Q Het
Clic6 T A 16: 92,499,387 S312T probably benign Het
Col5a2 T C 1: 45,404,987 probably null Het
Ctc1 C A 11: 69,026,529 Q384K probably damaging Het
Defa24 A G 8: 21,734,540 K2E probably damaging Het
Dis3l C A 9: 64,322,471 A309S probably benign Het
Dnah9 A G 11: 66,072,072 S1806P probably damaging Het
Dolk C T 2: 30,284,714 V440I probably damaging Het
Erc2 A G 14: 28,040,341 probably null Het
Fntb T C 12: 76,873,450 probably null Het
Gm12569 C T 11: 51,234,838 S196L probably damaging Het
Gm4846 A T 1: 166,494,659 V113E probably benign Het
Gm5592 G T 7: 41,286,759 Q228H probably damaging Het
Gm5916 T A 9: 36,120,995 T48S possibly damaging Het
Ift172 G T 5: 31,283,081 Y287* probably null Het
Il27ra T C 8: 84,033,985 I450M probably damaging Het
Krtap31-2 T A 11: 99,936,551 C70S possibly damaging Het
Lipo4 T A 19: 33,501,564 H292L probably damaging Het
Lyst T C 13: 13,740,569 F3283L probably damaging Het
Mctp1 T G 13: 76,827,757 C750G probably damaging Het
Mtmr7 T C 8: 40,551,735 D600G possibly damaging Het
Mylk C T 16: 34,963,648 Q1395* probably null Het
Nap1l5 T A 6: 58,906,888 D27V probably damaging Het
Nfkbib T C 7: 28,762,087 D75G probably damaging Het
Nlrc4 T A 17: 74,437,508 M793L probably benign Het
Olfr451-ps1 T A 6: 42,801,492 C250* probably null Het
Olfr472 T C 7: 107,903,043 S109P probably benign Het
Olfr599 G T 7: 103,338,330 C92F probably benign Het
Olfr832 T C 9: 18,945,503 M285T probably benign Het
Olfr970 C T 9: 39,820,014 A125V probably damaging Het
Pcdh15 G A 10: 74,642,314 R207Q probably damaging Het
Plek T C 11: 16,995,238 T54A probably benign Het
Pno1 C A 11: 17,211,443 R22L probably benign Het
Prkca A T 11: 108,012,684 N287K probably damaging Het
Rapgef6 C G 11: 54,626,723 H414D probably damaging Het
Rpa1 CA C 11: 75,307,224 probably null Het
Rpap2 T C 5: 107,606,911 C136R probably damaging Het
Rtl1 C T 12: 109,592,817 E863K possibly damaging Het
Ryr3 A T 2: 112,926,912 I366N probably damaging Het
Scn9a T C 2: 66,543,112 I508V probably benign Het
Sec14l3 A G 11: 4,074,795 D248G probably damaging Het
Six6 A T 12: 72,940,543 Q163L probably benign Het
Slco6c1 A G 1: 97,062,467 V683A possibly damaging Het
Smc1b A G 15: 85,066,328 V1165A probably damaging Het
Smgc A T 15: 91,847,076 Q241L possibly damaging Het
Tdrp A T 8: 13,955,727 S65T probably damaging Het
Tg A T 15: 66,683,814 Y785F probably damaging Het
Themis2 T G 4: 132,789,643 Q182P probably damaging Het
Tmem86b G T 7: 4,628,405 S216* probably null Het
Ttyh2 T A 11: 114,686,446 I61N possibly damaging Het
Vmn2r97 A T 17: 18,929,540 T397S probably benign Het
Zfp141 C T 7: 42,476,479 D190N probably damaging Het
Zfp58 T C 13: 67,491,995 R126G possibly damaging Het
Other mutations in Carmil1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Carmil1 APN 13 24111838 missense possibly damaging 0.68
IGL00392:Carmil1 APN 13 24094491 missense probably damaging 1.00
IGL00943:Carmil1 APN 13 24111886 missense possibly damaging 0.48
IGL01375:Carmil1 APN 13 24094471 missense possibly damaging 0.88
IGL02043:Carmil1 APN 13 24024316 unclassified probably benign
IGL02122:Carmil1 APN 13 24036558 missense possibly damaging 0.95
IGL02178:Carmil1 APN 13 24094403 missense probably damaging 1.00
IGL02264:Carmil1 APN 13 24075716 missense possibly damaging 0.95
IGL02269:Carmil1 APN 13 24155410 nonsense probably null
IGL02546:Carmil1 APN 13 24115499 missense probably damaging 0.98
IGL02740:Carmil1 APN 13 24094518 missense probably damaging 0.98
IGL02876:Carmil1 APN 13 24154668 unclassified probably benign
IGL02976:Carmil1 APN 13 24092551 missense possibly damaging 0.96
IGL03012:Carmil1 APN 13 24036372 missense probably benign 0.19
IGL03107:Carmil1 APN 13 24094455 missense probably damaging 0.99
H8562:Carmil1 UTSW 13 24064647 missense probably benign 0.00
R0085:Carmil1 UTSW 13 24025867 missense probably benign
R0119:Carmil1 UTSW 13 24082020 missense probably damaging 0.98
R0166:Carmil1 UTSW 13 24099049 missense probably damaging 1.00
R0299:Carmil1 UTSW 13 24082020 missense probably damaging 0.98
R0304:Carmil1 UTSW 13 24139341 missense probably damaging 0.99
R0335:Carmil1 UTSW 13 24073983 missense probably damaging 1.00
R0369:Carmil1 UTSW 13 24082020 missense probably damaging 0.98
R0462:Carmil1 UTSW 13 24022511 missense probably benign 0.01
R1203:Carmil1 UTSW 13 24099006 missense probably damaging 1.00
R1540:Carmil1 UTSW 13 24099054 missense possibly damaging 0.92
R1730:Carmil1 UTSW 13 24041689 missense probably damaging 1.00
R1770:Carmil1 UTSW 13 24173674 missense probably damaging 1.00
R1831:Carmil1 UTSW 13 24164879 missense probably benign 0.00
R1893:Carmil1 UTSW 13 24024463 missense possibly damaging 0.72
R2099:Carmil1 UTSW 13 24173667 missense probably benign 0.00
R2153:Carmil1 UTSW 13 24141673 missense probably damaging 0.97
R2296:Carmil1 UTSW 13 24115509 missense probably damaging 1.00
R2869:Carmil1 UTSW 13 24045068 synonymous silent
R2872:Carmil1 UTSW 13 24045068 synonymous silent
R3113:Carmil1 UTSW 13 24069757 missense probably benign 0.22
R3508:Carmil1 UTSW 13 24019676 utr 3 prime probably benign
R3780:Carmil1 UTSW 13 24137169 missense probably damaging 0.99
R3954:Carmil1 UTSW 13 24013407 missense probably benign 0.00
R4027:Carmil1 UTSW 13 24067223 splice site probably benign
R4086:Carmil1 UTSW 13 24024461 missense possibly damaging 0.56
R4647:Carmil1 UTSW 13 24137179 missense probably damaging 1.00
R4792:Carmil1 UTSW 13 24067190 missense probably damaging 1.00
R4792:Carmil1 UTSW 13 24141676 missense possibly damaging 0.96
R5012:Carmil1 UTSW 13 24024420 missense possibly damaging 0.81
R5166:Carmil1 UTSW 13 24154983 critical splice donor site probably null
R5199:Carmil1 UTSW 13 24111870 missense probably damaging 1.00
R5330:Carmil1 UTSW 13 24025946 splice site probably null
R5472:Carmil1 UTSW 13 24155471 missense probably damaging 0.97
R5478:Carmil1 UTSW 13 24112045 missense probably damaging 1.00
R5496:Carmil1 UTSW 13 24155450 missense probably damaging 1.00
R5775:Carmil1 UTSW 13 24276537 missense probably benign
R5789:Carmil1 UTSW 13 24121848 missense probably damaging 1.00
R5794:Carmil1 UTSW 13 24092550 missense probably damaging 1.00
R5977:Carmil1 UTSW 13 24069736 missense probably damaging 1.00
R6127:Carmil1 UTSW 13 24036352 missense probably benign 0.03
R6128:Carmil1 UTSW 13 24013194 nonsense probably null
R6403:Carmil1 UTSW 13 24081967 missense probably damaging 1.00
R6450:Carmil1 UTSW 13 24036564 missense probably damaging 0.98
R6451:Carmil1 UTSW 13 24092558 nonsense probably null
R6684:Carmil1 UTSW 13 24022542 missense unknown
R6891:Carmil1 UTSW 13 24141723 missense probably benign 0.13
R6902:Carmil1 UTSW 13 24115545 missense possibly damaging 0.79
R6924:Carmil1 UTSW 13 24075684 nonsense probably null
R6946:Carmil1 UTSW 13 24115545 missense possibly damaging 0.79
R7038:Carmil1 UTSW 13 24139335 missense probably damaging 1.00
R7179:Carmil1 UTSW 13 24020069 missense probably benign 0.00
R7282:Carmil1 UTSW 13 24013404 missense probably benign
R7286:Carmil1 UTSW 13 24013394 missense probably damaging 0.96
R7397:Carmil1 UTSW 13 24044311 missense probably damaging 0.99
R7412:Carmil1 UTSW 13 24098810 missense possibly damaging 0.50
R7611:Carmil1 UTSW 13 24013332 missense probably benign 0.30
R7642:Carmil1 UTSW 13 24067206 missense probably benign 0.12
R7827:Carmil1 UTSW 13 24036438 missense probably benign 0.00
R8014:Carmil1 UTSW 13 24036321 missense possibly damaging 0.71
R8068:Carmil1 UTSW 13 24075728 missense probably benign 0.00
R8361:Carmil1 UTSW 13 24067130 critical splice donor site probably null
R8469:Carmil1 UTSW 13 24112028 missense probably damaging 1.00
X0025:Carmil1 UTSW 13 24099043 missense possibly damaging 0.47
Z1088:Carmil1 UTSW 13 24044182 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAATGTGTAGCTGCCTCAG -3'
(R):5'- ATTTCAGCCTCAAGGAGAAGC -3'

Sequencing Primer
(F):5'- GTGTAGCTGCCTCAGAGAAATTC -3'
(R):5'- ACAGAAGCAACGGTCCTCGG -3'
Posted On2019-12-20