Incidental Mutation 'R7890:Smc1b'
ID609298
Institutional Source Beutler Lab
Gene Symbol Smc1b
Ensembl Gene ENSMUSG00000022432
Gene Namestructural maintenance of chromosomes 1B
SynonymsSMC1beta, Smc1l2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.737) question?
Stock #R7890 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location85064689-85131964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85066328 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1165 (V1165A)
Ref Sequence ENSEMBL: ENSMUSP00000023068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023068] [ENSMUST00000023069] [ENSMUST00000227591] [ENSMUST00000229203]
Predicted Effect probably damaging
Transcript: ENSMUST00000023068
AA Change: V1165A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023068
Gene: ENSMUSG00000022432
AA Change: V1165A

DomainStartEndE-ValueType
Pfam:AAA_23 7 361 2e-10 PFAM
Pfam:AAA_21 27 372 7.2e-9 PFAM
low complexity region 422 437 N/A INTRINSIC
SMC_hinge 513 629 1.5e-23 SMART
PDB:1W1W|D 1046 1218 3e-42 PDB
Blast:AAA 1063 1217 5e-25 BLAST
SCOP:d1e69a_ 1114 1202 3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000023069
SMART Domains Protein: ENSMUSP00000023069
Gene: ENSMUSG00000022434

DomainStartEndE-ValueType
Pfam:SIR2_2 142 286 7.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227591
Predicted Effect probably benign
Transcript: ENSMUST00000229203
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SMC1L2 belongs to a family of proteins required for chromatid cohesion and DNA recombination during meiosis and mitosis (3:Revenkova et al., 2001 [PubMed 11564881]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant mice display male and female infertility, abnormal male and female meiosis, and arrest of spematogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh T A 5: 76,884,122 K551N probably benign Het
Acp4 A C 7: 44,254,104 L262R probably damaging Het
Acsf3 G T 8: 122,785,965 probably null Het
Ago4 T C 4: 126,526,076 Q36R probably benign Het
Ankrd31 T A 13: 96,831,871 I672K probably benign Het
Astn1 A T 1: 158,580,333 D628V probably damaging Het
Brca2 T C 5: 150,539,381 V870A possibly damaging Het
Camk4 T C 18: 33,185,005 V405A probably benign Het
Carmil1 A T 13: 24,013,232 S146T Het
Cflar T A 1: 58,752,756 L406Q Het
Clic6 T A 16: 92,499,387 S312T probably benign Het
Col5a2 T C 1: 45,404,987 probably null Het
Ctc1 C A 11: 69,026,529 Q384K probably damaging Het
Defa24 A G 8: 21,734,540 K2E probably damaging Het
Dis3l C A 9: 64,322,471 A309S probably benign Het
Dnah9 A G 11: 66,072,072 S1806P probably damaging Het
Dolk C T 2: 30,284,714 V440I probably damaging Het
Erc2 A G 14: 28,040,341 probably null Het
Fntb T C 12: 76,873,450 probably null Het
Gm12569 C T 11: 51,234,838 S196L probably damaging Het
Gm4846 A T 1: 166,494,659 V113E probably benign Het
Gm5592 G T 7: 41,286,759 Q228H probably damaging Het
Gm5916 T A 9: 36,120,995 T48S possibly damaging Het
Ift172 G T 5: 31,283,081 Y287* probably null Het
Il27ra T C 8: 84,033,985 I450M probably damaging Het
Krtap31-2 T A 11: 99,936,551 C70S possibly damaging Het
Lipo4 T A 19: 33,501,564 H292L probably damaging Het
Lyst T C 13: 13,740,569 F3283L probably damaging Het
Mctp1 T G 13: 76,827,757 C750G probably damaging Het
Mtmr7 T C 8: 40,551,735 D600G possibly damaging Het
Mylk C T 16: 34,963,648 Q1395* probably null Het
Nap1l5 T A 6: 58,906,888 D27V probably damaging Het
Nfkbib T C 7: 28,762,087 D75G probably damaging Het
Nlrc4 T A 17: 74,437,508 M793L probably benign Het
Olfr451-ps1 T A 6: 42,801,492 C250* probably null Het
Olfr472 T C 7: 107,903,043 S109P probably benign Het
Olfr599 G T 7: 103,338,330 C92F probably benign Het
Olfr832 T C 9: 18,945,503 M285T probably benign Het
Olfr970 C T 9: 39,820,014 A125V probably damaging Het
Pcdh15 G A 10: 74,642,314 R207Q probably damaging Het
Plek T C 11: 16,995,238 T54A probably benign Het
Pno1 C A 11: 17,211,443 R22L probably benign Het
Prkca A T 11: 108,012,684 N287K probably damaging Het
Rapgef6 C G 11: 54,626,723 H414D probably damaging Het
Rpa1 CA C 11: 75,307,224 probably null Het
Rpap2 T C 5: 107,606,911 C136R probably damaging Het
Rtl1 C T 12: 109,592,817 E863K possibly damaging Het
Ryr3 A T 2: 112,926,912 I366N probably damaging Het
Scn9a T C 2: 66,543,112 I508V probably benign Het
Sec14l3 A G 11: 4,074,795 D248G probably damaging Het
Six6 A T 12: 72,940,543 Q163L probably benign Het
Slco6c1 A G 1: 97,062,467 V683A possibly damaging Het
Smgc A T 15: 91,847,076 Q241L possibly damaging Het
Tdrp A T 8: 13,955,727 S65T probably damaging Het
Tg A T 15: 66,683,814 Y785F probably damaging Het
Themis2 T G 4: 132,789,643 Q182P probably damaging Het
Tmem86b G T 7: 4,628,405 S216* probably null Het
Ttyh2 T A 11: 114,686,446 I61N possibly damaging Het
Vmn2r97 A T 17: 18,929,540 T397S probably benign Het
Zfp141 C T 7: 42,476,479 D190N probably damaging Het
Zfp58 T C 13: 67,491,995 R126G possibly damaging Het
Other mutations in Smc1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Smc1b APN 15 85129700 missense possibly damaging 0.95
IGL01293:Smc1b APN 15 85131898 missense probably damaging 1.00
IGL01656:Smc1b APN 15 85114776 missense probably damaging 0.99
IGL01807:Smc1b APN 15 85096745 missense probably damaging 0.97
IGL02094:Smc1b APN 15 85097891 splice site probably benign
IGL02121:Smc1b APN 15 85097985 missense probably benign
IGL02631:Smc1b APN 15 85107003 missense probably damaging 0.98
IGL02678:Smc1b APN 15 85065000 nonsense probably null
IGL03197:Smc1b APN 15 85070863 missense possibly damaging 0.85
IGL03214:Smc1b APN 15 85097946 nonsense probably null
IGL03218:Smc1b APN 15 85089713 missense probably benign 0.07
IGL03232:Smc1b APN 15 85129720 missense possibly damaging 0.68
adamantine UTSW 15 85121641 missense probably benign 0.06
unbreakable UTSW 15 85096658 missense probably benign
E0370:Smc1b UTSW 15 85127581 missense probably damaging 1.00
PIT4812001:Smc1b UTSW 15 85069651 missense possibly damaging 0.91
R0092:Smc1b UTSW 15 85067724 unclassified probably benign
R0106:Smc1b UTSW 15 85070819 missense probably damaging 1.00
R0106:Smc1b UTSW 15 85070819 missense probably damaging 1.00
R0207:Smc1b UTSW 15 85123759 missense probably benign
R0390:Smc1b UTSW 15 85066277 missense probably damaging 1.00
R0440:Smc1b UTSW 15 85112673 splice site probably benign
R0685:Smc1b UTSW 15 85070820 missense possibly damaging 0.92
R1109:Smc1b UTSW 15 85112815 missense probably damaging 0.98
R1392:Smc1b UTSW 15 85107070 splice site probably benign
R1509:Smc1b UTSW 15 85086134 missense probably benign
R1804:Smc1b UTSW 15 85127790 missense possibly damaging 0.90
R1879:Smc1b UTSW 15 85092067 missense probably benign 0.01
R2086:Smc1b UTSW 15 85121851 splice site probably benign
R2143:Smc1b UTSW 15 85123802 missense probably benign
R2158:Smc1b UTSW 15 85121851 splice site probably benign
R2174:Smc1b UTSW 15 85121851 splice site probably benign
R2471:Smc1b UTSW 15 85092017 missense probably damaging 0.98
R3689:Smc1b UTSW 15 85117263 intron probably benign
R3690:Smc1b UTSW 15 85117263 intron probably benign
R4178:Smc1b UTSW 15 85120647 missense possibly damaging 0.94
R4420:Smc1b UTSW 15 85112830 missense probably damaging 1.00
R4905:Smc1b UTSW 15 85066227 missense probably damaging 1.00
R4919:Smc1b UTSW 15 85117104 intron probably benign
R5114:Smc1b UTSW 15 85064984 missense probably damaging 1.00
R5314:Smc1b UTSW 15 85070865 missense probably benign 0.00
R5476:Smc1b UTSW 15 85086151 missense probably damaging 0.97
R5593:Smc1b UTSW 15 85121641 missense probably benign 0.06
R5690:Smc1b UTSW 15 85112773 missense probably damaging 1.00
R5719:Smc1b UTSW 15 85096658 missense probably benign
R5817:Smc1b UTSW 15 85067783 missense probably damaging 0.99
R5834:Smc1b UTSW 15 85089665 missense probably damaging 1.00
R5930:Smc1b UTSW 15 85086121 missense probably damaging 1.00
R6032:Smc1b UTSW 15 85066229 missense possibly damaging 0.92
R6032:Smc1b UTSW 15 85066229 missense possibly damaging 0.92
R6049:Smc1b UTSW 15 85121695 missense probably damaging 1.00
R6306:Smc1b UTSW 15 85127623 missense probably benign 0.30
R6392:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6426:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6435:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6436:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6437:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6508:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6512:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6703:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6737:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6775:Smc1b UTSW 15 85089680 missense probably damaging 0.96
R6889:Smc1b UTSW 15 85067759 missense probably damaging 1.00
R6908:Smc1b UTSW 15 85107010 missense probably damaging 1.00
R7124:Smc1b UTSW 15 85071597 missense probably damaging 0.98
R7400:Smc1b UTSW 15 85069720 missense probably damaging 1.00
R7417:Smc1b UTSW 15 85097542 missense probably benign 0.05
R7610:Smc1b UTSW 15 85070820 missense possibly damaging 0.92
R7873:Smc1b UTSW 15 85110650 critical splice donor site probably null
R8004:Smc1b UTSW 15 85097614 missense probably damaging 0.98
Z1176:Smc1b UTSW 15 85131903 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGGAAGTCCCAAGGCTGG -3'
(R):5'- AATTGAGCTTCCTGAAGGAGCTAG -3'

Sequencing Primer
(F):5'- CCAAGGCTGGCAGGGTC -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2019-12-20