Incidental Mutation 'R7890:Camk4'
ID609304
Institutional Source Beutler Lab
Gene Symbol Camk4
Ensembl Gene ENSMUSG00000038128
Gene Namecalcium/calmodulin-dependent protein kinase IV
SynonymsD18Bwg0362e, CaMKIV/Gr, CaMKIV, Ca2+/calmodulin-dependent protein kinase type IV/Gr, A430110E23Rik
MMRRC Submission
Accession Numbers

Genbank: NM_009793; MGI: 88258

Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R7890 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location32939041-33195767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33185005 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 405 (V405A)
Ref Sequence ENSEMBL: ENSMUSP00000046539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042868]
Predicted Effect probably benign
Transcript: ENSMUST00000042868
AA Change: V405A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000046539
Gene: ENSMUSG00000038128
AA Change: V405A

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
S_TKc 42 296 8.7e-106 SMART
low complexity region 318 344 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
low complexity region 415 428 N/A INTRINSIC
low complexity region 441 454 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the serine/threonine protein kinase family, and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. This enzyme is a multifunctional serine/threonine protein kinase with limited tissue distribution, that has been implicated in transcriptional regulation in lymphocytes, neurons and male germ cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for different targeted mutations show variable phenotypes, including reduced viability, male and/or female sterility, and mild to severe neurological and spatial memory disorders. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(3) Targeted, other(1)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh T A 5: 76,884,122 K551N probably benign Het
Acp4 A C 7: 44,254,104 L262R probably damaging Het
Acsf3 G T 8: 122,785,965 probably null Het
Ago4 T C 4: 126,526,076 Q36R probably benign Het
Ankrd31 T A 13: 96,831,871 I672K probably benign Het
Astn1 A T 1: 158,580,333 D628V probably damaging Het
Brca2 T C 5: 150,539,381 V870A possibly damaging Het
Carmil1 A T 13: 24,013,232 S146T Het
Cflar T A 1: 58,752,756 L406Q Het
Clic6 T A 16: 92,499,387 S312T probably benign Het
Col5a2 T C 1: 45,404,987 probably null Het
Ctc1 C A 11: 69,026,529 Q384K probably damaging Het
Defa24 A G 8: 21,734,540 K2E probably damaging Het
Dis3l C A 9: 64,322,471 A309S probably benign Het
Dnah9 A G 11: 66,072,072 S1806P probably damaging Het
Dolk C T 2: 30,284,714 V440I probably damaging Het
Erc2 A G 14: 28,040,341 probably null Het
Fntb T C 12: 76,873,450 probably null Het
Gm12569 C T 11: 51,234,838 S196L probably damaging Het
Gm4846 A T 1: 166,494,659 V113E probably benign Het
Gm5592 G T 7: 41,286,759 Q228H probably damaging Het
Gm5916 T A 9: 36,120,995 T48S possibly damaging Het
Ift172 G T 5: 31,283,081 Y287* probably null Het
Il27ra T C 8: 84,033,985 I450M probably damaging Het
Krtap31-2 T A 11: 99,936,551 C70S possibly damaging Het
Lipo4 T A 19: 33,501,564 H292L probably damaging Het
Lyst T C 13: 13,740,569 F3283L probably damaging Het
Mctp1 T G 13: 76,827,757 C750G probably damaging Het
Mtmr7 T C 8: 40,551,735 D600G possibly damaging Het
Mylk C T 16: 34,963,648 Q1395* probably null Het
Nap1l5 T A 6: 58,906,888 D27V probably damaging Het
Nfkbib T C 7: 28,762,087 D75G probably damaging Het
Nlrc4 T A 17: 74,437,508 M793L probably benign Het
Olfr451-ps1 T A 6: 42,801,492 C250* probably null Het
Olfr472 T C 7: 107,903,043 S109P probably benign Het
Olfr599 G T 7: 103,338,330 C92F probably benign Het
Olfr832 T C 9: 18,945,503 M285T probably benign Het
Olfr970 C T 9: 39,820,014 A125V probably damaging Het
Pcdh15 G A 10: 74,642,314 R207Q probably damaging Het
Plek T C 11: 16,995,238 T54A probably benign Het
Pno1 C A 11: 17,211,443 R22L probably benign Het
Prkca A T 11: 108,012,684 N287K probably damaging Het
Rapgef6 C G 11: 54,626,723 H414D probably damaging Het
Rpa1 CA C 11: 75,307,224 probably null Het
Rpap2 T C 5: 107,606,911 C136R probably damaging Het
Rtl1 C T 12: 109,592,817 E863K possibly damaging Het
Ryr3 A T 2: 112,926,912 I366N probably damaging Het
Scn9a T C 2: 66,543,112 I508V probably benign Het
Sec14l3 A G 11: 4,074,795 D248G probably damaging Het
Six6 A T 12: 72,940,543 Q163L probably benign Het
Slco6c1 A G 1: 97,062,467 V683A possibly damaging Het
Smc1b A G 15: 85,066,328 V1165A probably damaging Het
Smgc A T 15: 91,847,076 Q241L possibly damaging Het
Tdrp A T 8: 13,955,727 S65T probably damaging Het
Tg A T 15: 66,683,814 Y785F probably damaging Het
Themis2 T G 4: 132,789,643 Q182P probably damaging Het
Tmem86b G T 7: 4,628,405 S216* probably null Het
Ttyh2 T A 11: 114,686,446 I61N possibly damaging Het
Vmn2r97 A T 17: 18,929,540 T397S probably benign Het
Zfp141 C T 7: 42,476,479 D190N probably damaging Het
Zfp58 T C 13: 67,491,995 R126G possibly damaging Het
Other mutations in Camk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
7510:Camk4 UTSW 18 33156839 missense probably null 0.99
R0244:Camk4 UTSW 18 33179625 critical splice donor site probably null
R0408:Camk4 UTSW 18 33129792 missense probably damaging 1.00
R0744:Camk4 UTSW 18 32939454 missense unknown
R0836:Camk4 UTSW 18 32939454 missense unknown
R0903:Camk4 UTSW 18 33182330 missense probably benign 0.08
R1449:Camk4 UTSW 18 32939475 missense probably damaging 0.99
R1456:Camk4 UTSW 18 33129843 splice site probably benign
R1677:Camk4 UTSW 18 33176222 missense probably damaging 1.00
R1733:Camk4 UTSW 18 33078021 missense possibly damaging 0.54
R1909:Camk4 UTSW 18 33158816 splice site probably null
R2186:Camk4 UTSW 18 33182341 missense probably damaging 0.99
R2291:Camk4 UTSW 18 33107943 critical splice donor site probably null
R3874:Camk4 UTSW 18 33158854 missense possibly damaging 0.70
R3968:Camk4 UTSW 18 33179581 missense possibly damaging 0.94
R3969:Camk4 UTSW 18 33179581 missense possibly damaging 0.94
R3970:Camk4 UTSW 18 33179581 missense possibly damaging 0.94
R4858:Camk4 UTSW 18 33176213 missense probably damaging 0.98
R5251:Camk4 UTSW 18 33184879 missense probably benign 0.31
R5343:Camk4 UTSW 18 33078069 missense probably damaging 0.99
R5972:Camk4 UTSW 18 33107926 missense probably damaging 1.00
R6155:Camk4 UTSW 18 32939447 missense unknown
R6728:Camk4 UTSW 18 33184939 missense probably benign
R7088:Camk4 UTSW 18 32939531 missense probably benign 0.02
R7135:Camk4 UTSW 18 33107943 critical splice donor site probably null
R7372:Camk4 UTSW 18 33185125 missense probably benign 0.34
R7490:Camk4 UTSW 18 32939545 critical splice donor site probably null
R7525:Camk4 UTSW 18 33185032 missense probably benign 0.04
R8446:Camk4 UTSW 18 33156757 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAATTGGCAATTTCCCCTGG -3'
(R):5'- ATCGCATCCTGCTGTGGAAC -3'

Sequencing Primer
(F):5'- TCTCTCCAATCAGGCAGCG -3'
(R):5'- ATCCTGCTGTGGAACCCCAAG -3'
Posted On2019-12-20