Incidental Mutation 'R7891:Acsl3'
ID609310
Institutional Source Beutler Lab
Gene Symbol Acsl3
Ensembl Gene ENSMUSG00000032883
Gene Nameacyl-CoA synthetase long-chain family member 3
Synonyms2610510B12Rik, Facl3, C85929
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.689) question?
Stock #R7891 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location78657825-78707743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 78703588 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 612 (A612V)
Ref Sequence ENSEMBL: ENSMUSP00000045291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035779] [ENSMUST00000134566] [ENSMUST00000142704]
Predicted Effect probably benign
Transcript: ENSMUST00000035779
AA Change: A612V

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000045291
Gene: ENSMUSG00000032883
AA Change: A612V

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134566
AA Change: A460V

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000117952
Gene: ENSMUSG00000032883
AA Change: A460V

DomainStartEndE-ValueType
Pfam:AMP-binding 1 435 4.3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142704
AA Change: A612V

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000121695
Gene: ENSMUSG00000032883
AA Change: A612V

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2.5e-106 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of the long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme is highly expressed in brain, and preferentially utilizes myristate, arachidonate, and eicosapentaenoate as substrates. The amino acid sequence of this isozyme is 92% identical to that of rat homolog. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice exhibit decreased blood percentages of CD4 T cells and B cells, and a decreased IgG1 response to ovalbumin. Male mutant mice exhibit growth retardation, reduced size and reduced total tissue and lean body mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T G 2: 165,078,944 E56D unknown Het
9930111J21Rik2 T C 11: 49,019,716 Q630R probably benign Het
Abca9 A G 11: 110,163,272 V68A probably benign Het
Acnat1 G A 4: 49,449,181 A195V possibly damaging Het
Adam12 A T 7: 133,998,232 D115E probably benign Het
Adam3 T A 8: 24,707,497 probably null Het
Aif1 G A 17: 35,172,624 probably benign Het
Ank3 A G 10: 69,988,309 D154G probably damaging Het
Arid3b A G 9: 57,810,159 C233R probably benign Het
Ccdc7b T A 8: 129,072,665 D74E unknown Het
Cckbr T A 7: 105,435,350 D430E probably benign Het
Chpf T C 1: 75,475,295 H667R probably benign Het
Dnah8 A G 17: 30,712,289 E1426G probably benign Het
Dync1h1 A G 12: 110,643,156 I2791V probably benign Het
Ehd3 A G 17: 73,816,392 N130S probably benign Het
Fam198b G A 3: 79,886,284 A20T probably benign Het
Fgfr4 A G 13: 55,159,151 T218A probably benign Het
Foxe1 G A 4: 46,344,599 E136K possibly damaging Het
Frmpd1 A G 4: 45,284,478 S1100G probably benign Het
Gm21886 T G 18: 80,089,757 Q62P probably null Het
Golga4 A G 9: 118,556,366 E852G probably damaging Het
Gprin3 T C 6: 59,353,711 D537G probably benign Het
Gpx5 C A 13: 21,288,748 D139Y probably damaging Het
Hmcn1 T C 1: 150,593,189 Y5007C probably damaging Het
Igsf10 G A 3: 59,328,411 R1450* probably null Het
Kif21a G A 15: 90,956,314 P1200S probably damaging Het
Kmt2c G A 5: 25,300,111 R3400C probably damaging Het
Miox A C 15: 89,336,539 M216L probably benign Het
Mphosph9 T C 5: 124,290,904 Y687C probably damaging Het
Mxi1 T A 19: 53,310,761 V21D probably benign Het
Nbeal1 T C 1: 60,260,432 L1309P probably benign Het
Olfr1116 A T 2: 87,269,077 T99S possibly damaging Het
Olfr1186 G A 2: 88,525,945 V121I probably benign Het
Olfr272 C T 4: 52,911,663 V44I probably benign Het
Olfr837 T C 9: 19,137,845 M284T possibly damaging Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Polq A G 16: 37,027,882 T284A probably damaging Het
Polrmt A T 10: 79,741,880 M295K probably damaging Het
Pou2af1 G T 9: 51,232,997 M70I probably damaging Het
Pou3f1 G A 4: 124,658,439 E245K probably damaging Het
Psmb1 C T 17: 15,494,486 V50I probably benign Het
Ptgis T C 2: 167,227,514 D50G probably damaging Het
R3hdm2 A G 10: 127,498,574 I955M probably benign Het
Rasef G A 4: 73,759,698 T97I probably benign Het
Rasef T C 4: 73,790,964 T11A probably benign Het
Sema4c C A 1: 36,549,914 L710F probably damaging Het
Slc39a10 C T 1: 46,812,168 A721T probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Spata31d1a A G 13: 59,700,325 C1330R possibly damaging Het
Susd1 T C 4: 59,349,915 D560G possibly damaging Het
Tnfrsf1b T C 4: 145,229,090 Y32C probably damaging Het
Trhr2 C A 8: 122,357,344 V306F probably damaging Het
Trpm6 A T 19: 18,776,710 Q35L probably benign Het
Ttbk2 A G 2: 120,786,029 S197P probably damaging Het
Uggt2 T A 14: 119,042,647 E806D probably benign Het
Ushbp1 T G 8: 71,388,778 Q469P possibly damaging Het
Vmn1r73 G A 7: 11,757,109 V285I possibly damaging Het
Zfp934 A C 13: 62,520,189 S63R probably benign Het
Other mutations in Acsl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Acsl3 APN 1 78699759 missense possibly damaging 0.79
IGL02201:Acsl3 APN 1 78699153 missense probably damaging 1.00
IGL03162:Acsl3 APN 1 78699170 critical splice donor site probably null
R0601:Acsl3 UTSW 1 78696179 missense probably damaging 1.00
R0658:Acsl3 UTSW 1 78701287 missense probably damaging 1.00
R1389:Acsl3 UTSW 1 78688282 missense probably benign
R1468:Acsl3 UTSW 1 78706409 missense probably benign 0.03
R1468:Acsl3 UTSW 1 78706409 missense probably benign 0.03
R1697:Acsl3 UTSW 1 78705397 splice site probably benign
R2083:Acsl3 UTSW 1 78699811 missense probably damaging 0.99
R2125:Acsl3 UTSW 1 78681961 missense probably damaging 0.97
R2191:Acsl3 UTSW 1 78699140 missense probably damaging 1.00
R2299:Acsl3 UTSW 1 78699110 missense probably damaging 1.00
R2395:Acsl3 UTSW 1 78705368 missense probably benign 0.00
R2964:Acsl3 UTSW 1 78694294 missense probably benign 0.01
R3403:Acsl3 UTSW 1 78696122 missense probably damaging 1.00
R4655:Acsl3 UTSW 1 78690346 missense probably damaging 1.00
R5537:Acsl3 UTSW 1 78706356 missense probably damaging 1.00
R5823:Acsl3 UTSW 1 78688286 missense probably benign
R6239:Acsl3 UTSW 1 78696465 missense probably benign 0.00
R6376:Acsl3 UTSW 1 78696465 missense possibly damaging 0.81
R6650:Acsl3 UTSW 1 78681922 missense probably benign 0.03
R7031:Acsl3 UTSW 1 78688283 missense probably benign
R7282:Acsl3 UTSW 1 78681992 missense probably damaging 0.97
R7733:Acsl3 UTSW 1 78688236 critical splice acceptor site probably null
R7974:Acsl3 UTSW 1 78703588 missense probably benign 0.02
R7998:Acsl3 UTSW 1 78694271 missense probably damaging 1.00
R8056:Acsl3 UTSW 1 78681894 missense probably damaging 1.00
X0025:Acsl3 UTSW 1 78692202 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAATCTCAACTTTAGGGCAGCC -3'
(R):5'- CTCACTAGCTATGCAGAGGAG -3'

Sequencing Primer
(F):5'- GCAGCCATCCATGCTTAGTTGAG -3'
(R):5'- CTAGCTATGCAGAGGAGGTGGTG -3'
Posted On2019-12-20