Incidental Mutation 'R7891:Olfr1186'
ID609313
Institutional Source Beutler Lab
Gene Symbol Olfr1186
Ensembl Gene ENSMUSG00000082882
Gene Nameolfactory receptor 1186
SynonymsGA_x6K02T2Q125-50012960-50013871, MOR230-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7891 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location88518551-88526790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88525945 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 121 (V121I)
Ref Sequence ENSEMBL: ENSMUSP00000151114 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000121619
AA Change: V121I

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000215912
AA Change: V121I

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000216978
AA Change: V121I

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T G 2: 165,078,944 E56D unknown Het
9930111J21Rik2 T C 11: 49,019,716 Q630R probably benign Het
Abca9 A G 11: 110,163,272 V68A probably benign Het
Acnat1 G A 4: 49,449,181 A195V possibly damaging Het
Acsl3 C T 1: 78,703,588 A612V probably benign Het
Adam12 A T 7: 133,998,232 D115E probably benign Het
Adam3 T A 8: 24,707,497 probably null Het
Aif1 G A 17: 35,172,624 probably benign Het
Ank3 A G 10: 69,988,309 D154G probably damaging Het
Arid3b A G 9: 57,810,159 C233R probably benign Het
Ccdc7b T A 8: 129,072,665 D74E unknown Het
Cckbr T A 7: 105,435,350 D430E probably benign Het
Chpf T C 1: 75,475,295 H667R probably benign Het
Dnah8 A G 17: 30,712,289 E1426G probably benign Het
Dync1h1 A G 12: 110,643,156 I2791V probably benign Het
Ehd3 A G 17: 73,816,392 N130S probably benign Het
Fam198b G A 3: 79,886,284 A20T probably benign Het
Fgfr4 A G 13: 55,159,151 T218A probably benign Het
Foxe1 G A 4: 46,344,599 E136K possibly damaging Het
Frmpd1 A G 4: 45,284,478 S1100G probably benign Het
Gm21886 T G 18: 80,089,757 Q62P probably null Het
Golga4 A G 9: 118,556,366 E852G probably damaging Het
Gprin3 T C 6: 59,353,711 D537G probably benign Het
Gpx5 C A 13: 21,288,748 D139Y probably damaging Het
Hmcn1 T C 1: 150,593,189 Y5007C probably damaging Het
Igsf10 G A 3: 59,328,411 R1450* probably null Het
Kif21a G A 15: 90,956,314 P1200S probably damaging Het
Kmt2c G A 5: 25,300,111 R3400C probably damaging Het
Miox A C 15: 89,336,539 M216L probably benign Het
Mphosph9 T C 5: 124,290,904 Y687C probably damaging Het
Mxi1 T A 19: 53,310,761 V21D probably benign Het
Nbeal1 T C 1: 60,260,432 L1309P probably benign Het
Olfr1116 A T 2: 87,269,077 T99S possibly damaging Het
Olfr272 C T 4: 52,911,663 V44I probably benign Het
Olfr837 T C 9: 19,137,845 M284T possibly damaging Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Polq A G 16: 37,027,882 T284A probably damaging Het
Polrmt A T 10: 79,741,880 M295K probably damaging Het
Pou2af1 G T 9: 51,232,997 M70I probably damaging Het
Pou3f1 G A 4: 124,658,439 E245K probably damaging Het
Psmb1 C T 17: 15,494,486 V50I probably benign Het
Ptgis T C 2: 167,227,514 D50G probably damaging Het
R3hdm2 A G 10: 127,498,574 I955M probably benign Het
Rasef G A 4: 73,759,698 T97I probably benign Het
Rasef T C 4: 73,790,964 T11A probably benign Het
Sema4c C A 1: 36,549,914 L710F probably damaging Het
Slc39a10 C T 1: 46,812,168 A721T probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Spata31d1a A G 13: 59,700,325 C1330R possibly damaging Het
Susd1 T C 4: 59,349,915 D560G possibly damaging Het
Tnfrsf1b T C 4: 145,229,090 Y32C probably damaging Het
Trhr2 C A 8: 122,357,344 V306F probably damaging Het
Trpm6 A T 19: 18,776,710 Q35L probably benign Het
Ttbk2 A G 2: 120,786,029 S197P probably damaging Het
Uggt2 T A 14: 119,042,647 E806D probably benign Het
Ushbp1 T G 8: 71,388,778 Q469P possibly damaging Het
Vmn1r73 G A 7: 11,757,109 V285I possibly damaging Het
Zfp934 A C 13: 62,520,189 S63R probably benign Het
Other mutations in Olfr1186
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Olfr1186 APN 2 88525760 missense possibly damaging 0.87
IGL01727:Olfr1186 APN 2 88525927 missense probably benign 0.03
IGL01790:Olfr1186 APN 2 88526423 missense probably damaging 0.99
IGL01868:Olfr1186 APN 2 88525715 missense possibly damaging 0.66
IGL03146:Olfr1186 APN 2 88526144 missense possibly damaging 0.90
IGL03378:Olfr1186 APN 2 88526154 nonsense probably null
R0053:Olfr1186 UTSW 2 88526163 missense probably damaging 1.00
R0829:Olfr1186 UTSW 2 88526228 missense probably damaging 1.00
R1210:Olfr1186 UTSW 2 88526276 missense possibly damaging 0.89
R1754:Olfr1186 UTSW 2 88525815 missense probably damaging 0.99
R2260:Olfr1186 UTSW 2 88526386 missense possibly damaging 0.93
R3426:Olfr1186 UTSW 2 88525864 missense probably damaging 1.00
R3781:Olfr1186 UTSW 2 88526365 missense probably benign 0.23
R4737:Olfr1186 UTSW 2 88526225 missense probably damaging 1.00
R4908:Olfr1186 UTSW 2 88525910 missense probably damaging 1.00
R4932:Olfr1186 UTSW 2 88525735 missense probably benign 0.02
R5071:Olfr1186 UTSW 2 88526041 missense probably damaging 1.00
R5831:Olfr1186 UTSW 2 88526480 nonsense probably null
R6222:Olfr1186 UTSW 2 88499270 missense probably benign 0.34
R6370:Olfr1186 UTSW 2 88499368 nonsense probably null
R6802:Olfr1186 UTSW 2 88525597 missense probably benign 0.02
R6931:Olfr1186 UTSW 2 88526194 missense possibly damaging 0.50
R7044:Olfr1186 UTSW 2 88526486 missense probably benign
R7121:Olfr1186 UTSW 2 88525826 missense probably damaging 1.00
R7166:Olfr1186 UTSW 2 88525646 missense possibly damaging 0.89
R7387:Olfr1186 UTSW 2 88526400 nonsense probably null
R7951:Olfr1186 UTSW 2 88525804 missense probably damaging 0.98
R7978:Olfr1186 UTSW 2 88525670 nonsense probably null
R8016:Olfr1186 UTSW 2 88526173 missense probably damaging 0.99
R8039:Olfr1186 UTSW 2 88525871 missense probably benign 0.07
R8389:Olfr1186 UTSW 2 88525587 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- AGTCAGACACTTGGGAGTCC -3'
(R):5'- TTCAGTAAGGGCTGCAAATCACAG -3'

Sequencing Primer
(F):5'- GGGAGTCCCATGTACTTTTTCC -3'
(R):5'- GGCTGCAAATCACAGAAATAGTG -3'
Posted On2019-12-20