Incidental Mutation 'R0138:Def8'
ID60932
Institutional Source Beutler Lab
Gene Symbol Def8
Ensembl Gene ENSMUSG00000001482
Gene Namedifferentially expressed in FDCP 8
SynonymsD8Ertd713e
MMRRC Submission 038423-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R0138 (G1)
Quality Score208
Status Validated
Chromosome8
Chromosomal Location123423527-123463270 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 123456495 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 278 (A278T)
Ref Sequence ENSEMBL: ENSMUSP00000104460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001522] [ENSMUST00000065534] [ENSMUST00000093049] [ENSMUST00000108830] [ENSMUST00000108832] [ENSMUST00000124741] [ENSMUST00000127664] [ENSMUST00000128424] [ENSMUST00000132063] [ENSMUST00000212391] [ENSMUST00000212827] [ENSMUST00000212883]
Predicted Effect probably damaging
Transcript: ENSMUST00000001522
AA Change: A266T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000001522
Gene: ENSMUSG00000001482
AA Change: A266T

DomainStartEndE-ValueType
Blast:DUF4206 77 133 8e-28 BLAST
C1 148 198 4.12e-3 SMART
DUF4206 243 447 4.01e-121 SMART
C1 385 437 1.5e0 SMART
RING 399 440 4.86e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000065534
AA Change: A254T

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000070579
Gene: ENSMUSG00000001482
AA Change: A254T

DomainStartEndE-ValueType
Blast:DUF4206 65 121 7e-28 BLAST
C1 136 186 4.12e-3 SMART
DUF4206 231 435 4.01e-121 SMART
C1 373 425 1.5e0 SMART
RING 387 428 4.86e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000093049
AA Change: A254T

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000090737
Gene: ENSMUSG00000001482
AA Change: A254T

DomainStartEndE-ValueType
Blast:DUF4206 65 121 9e-28 BLAST
C1 136 186 4.12e-3 SMART
DUF4206 231 429 6.85e-106 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108830
AA Change: A254T

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104458
Gene: ENSMUSG00000001482
AA Change: A254T

DomainStartEndE-ValueType
Blast:DUF4206 65 121 7e-28 BLAST
C1 136 186 4.12e-3 SMART
DUF4206 231 435 4.01e-121 SMART
C1 373 425 1.5e0 SMART
RING 387 428 4.86e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108832
AA Change: A278T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104460
Gene: ENSMUSG00000001482
AA Change: A278T

DomainStartEndE-ValueType
Blast:DUF4206 89 145 9e-28 BLAST
C1 160 210 4.12e-3 SMART
DUF4206 255 459 4.01e-121 SMART
C1 397 449 1.5e0 SMART
RING 411 452 4.86e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124741
SMART Domains Protein: ENSMUSP00000122532
Gene: ENSMUSG00000001482

DomainStartEndE-ValueType
Blast:DUF4206 65 97 4e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128424
SMART Domains Protein: ENSMUSP00000115137
Gene: ENSMUSG00000001482

DomainStartEndE-ValueType
Blast:DUF4206 77 133 4e-30 BLAST
C1 148 198 4.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132063
Predicted Effect probably benign
Transcript: ENSMUST00000212391
Predicted Effect probably benign
Transcript: ENSMUST00000212827
Predicted Effect probably benign
Transcript: ENSMUST00000212883
Meta Mutation Damage Score 0.8511 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency 97% (76/78)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,105,449 N693K probably damaging Het
Adgrl3 T A 5: 81,693,607 V845D probably damaging Het
Anxa8 T A 14: 34,097,939 F269Y probably benign Het
Anxa8 T A 14: 34,097,940 F295L possibly damaging Het
Aox4 C G 1: 58,228,866 L202V probably damaging Het
Ap3s2 A G 7: 79,909,869 V104A probably benign Het
Aqp3 G A 4: 41,094,843 probably benign Het
Arhgef26 C T 3: 62,448,259 H751Y probably benign Het
Asic4 A T 1: 75,469,687 Q291L possibly damaging Het
Bap1 T C 14: 31,256,724 Y31H probably damaging Het
Brf1 A T 12: 112,961,139 V655D probably damaging Het
Cebpz A G 17: 78,931,391 S663P probably benign Het
Ces2h A G 8: 105,018,061 D357G probably benign Het
Cfap36 T C 11: 29,244,073 T90A probably benign Het
Ciita A T 16: 10,512,270 D803V probably damaging Het
Clnk C A 5: 38,774,608 probably benign Het
Cyp46a1 A G 12: 108,351,211 N158S probably damaging Het
Cyp4f13 A G 17: 32,941,106 I98T possibly damaging Het
Dll3 T A 7: 28,301,321 D103V possibly damaging Het
Dnaic1 T A 4: 41,629,814 M446K possibly damaging Het
Dppa4 A T 16: 48,291,062 T85S probably benign Het
Eif4g1 A T 16: 20,675,345 H57L probably damaging Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Fn1 T A 1: 71,624,110 Q1073L possibly damaging Het
Foxp4 T C 17: 47,869,179 D599G unknown Het
Frrs1 T C 3: 116,881,807 V128A possibly damaging Het
Gcfc2 G A 6: 81,949,954 D608N probably damaging Het
Gm1043 T C 5: 37,192,973 probably benign Het
Gm5148 T C 3: 37,714,777 E98G probably benign Het
Gpr141 T C 13: 19,752,258 I116V probably benign Het
Hic1 T C 11: 75,167,343 N240S probably damaging Het
Hpx G A 7: 105,592,238 T322I probably damaging Het
Hs3st4 A T 7: 124,397,193 M361L probably benign Het
Ifrd1 A G 12: 40,207,130 probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Klk1b21 T A 7: 44,105,895 C173S probably damaging Het
Krt25 A T 11: 99,322,698 V65E probably benign Het
Lrrc15 A T 16: 30,273,449 D357E possibly damaging Het
Lrrd1 T A 5: 3,851,345 V550E probably benign Het
Macf1 A G 4: 123,440,747 Y1490H probably damaging Het
Macrod1 A G 19: 7,196,916 probably benign Het
Mcm5 T A 8: 75,120,880 V435D probably damaging Het
Mctp1 C T 13: 76,827,712 R478C probably damaging Het
Med10 T C 13: 69,811,698 probably benign Het
Mrpl4 T C 9: 21,008,592 Y280H probably benign Het
Msrb3 T C 10: 120,851,987 E61G probably damaging Het
Myo1c T C 11: 75,661,001 Y337H possibly damaging Het
Myo7b T A 18: 32,010,151 T165S probably damaging Het
Myrfl T A 10: 116,849,233 R81W probably damaging Het
Neil1 T C 9: 57,143,746 probably benign Het
Neto2 A G 8: 85,641,044 I357T possibly damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nkx6-3 T C 8: 23,153,591 S3P probably benign Het
Olfr652 A T 7: 104,565,003 I261L probably benign Het
Plce1 T C 19: 38,524,419 I54T possibly damaging Het
Prex2 A T 1: 11,285,043 probably benign Het
Psapl1 T A 5: 36,204,631 V189E probably damaging Het
Ptdss2 T G 7: 141,155,319 probably benign Het
Rnf213 T C 11: 119,416,496 C661R probably benign Het
Rpap1 T C 2: 119,764,899 probably null Het
Rrp1b A G 17: 32,060,452 T696A probably benign Het
Sacm1l T A 9: 123,548,917 H87Q probably benign Het
Serpinb11 T A 1: 107,377,530 M212K probably damaging Het
Tbc1d22a C A 15: 86,299,684 T248K probably damaging Het
Tcerg1 C T 18: 42,568,614 probably benign Het
Tpst1 T A 5: 130,101,786 H32Q probably damaging Het
Tsc2 A T 17: 24,599,626 V1412E possibly damaging Het
Usp19 C A 9: 108,501,315 P1326Q possibly damaging Het
Vmn1r235 T A 17: 21,262,334 M307K probably damaging Het
Vmn2r58 T A 7: 41,837,624 T616S probably damaging Het
Vps13a G A 19: 16,660,499 T2406I possibly damaging Het
Zbtb26 T A 2: 37,436,041 M328L probably benign Het
Zp2 A G 7: 120,137,200 F340S probably damaging Het
Other mutations in Def8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Def8 APN 8 123459650 missense possibly damaging 0.95
IGL01896:Def8 APN 8 123459895 missense probably benign 0.29
IGL02424:Def8 APN 8 123459648 missense possibly damaging 0.65
IGL02982:Def8 APN 8 123456539 unclassified probably benign
IGL03218:Def8 APN 8 123456436 missense probably damaging 1.00
PIT4495001:Def8 UTSW 8 123459553 missense probably benign 0.00
R0003:Def8 UTSW 8 123456495 missense probably damaging 0.98
R0117:Def8 UTSW 8 123456495 missense probably damaging 0.98
R0119:Def8 UTSW 8 123456495 missense probably damaging 0.98
R0135:Def8 UTSW 8 123456495 missense probably damaging 0.98
R0141:Def8 UTSW 8 123456495 missense probably damaging 0.98
R0408:Def8 UTSW 8 123459917 missense probably damaging 1.00
R0636:Def8 UTSW 8 123454357 nonsense probably null
R3890:Def8 UTSW 8 123458344 unclassified probably benign
R3891:Def8 UTSW 8 123458344 unclassified probably benign
R3892:Def8 UTSW 8 123458344 unclassified probably benign
R4904:Def8 UTSW 8 123461480 missense probably damaging 0.96
R5930:Def8 UTSW 8 123460070 unclassified probably benign
R6088:Def8 UTSW 8 123460048 nonsense probably null
R6577:Def8 UTSW 8 123456710 missense probably benign 0.01
R7446:Def8 UTSW 8 123454322 missense probably damaging 1.00
R7498:Def8 UTSW 8 123447844 missense probably damaging 1.00
Z1088:Def8 UTSW 8 123456498 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCATTGGGAGAACCCCTAGCACAG -3'
(R):5'- TAGCTGAGTGACCAGCTTGCAGAG -3'

Sequencing Primer
(F):5'- AGATCCATACGATGTGAGTCCTTG -3'
(R):5'- CAGCTTGCAGAGCTAGGACTG -3'
Posted On2013-07-24