Incidental Mutation 'R7891:Susd1'
ID609323
Institutional Source Beutler Lab
Gene Symbol Susd1
Ensembl Gene ENSMUSG00000038578
Gene Namesushi domain containing 1
SynonymsGm12528
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R7891 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location59314683-59438633 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59349915 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 560 (D560G)
Ref Sequence ENSEMBL: ENSMUSP00000048201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040166] [ENSMUST00000107544]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040166
AA Change: D560G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048201
Gene: ENSMUSG00000038578
AA Change: D560G

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 16 30 N/A INTRINSIC
EGF 43 77 1.36e1 SMART
EGF_CA 78 129 2.92e-7 SMART
EGF_CA 130 180 2.22e-12 SMART
CCP 184 239 7.87e-9 SMART
CCP 244 299 5.48e-8 SMART
Blast:FN3 306 379 2e-6 BLAST
Blast:FN3 459 580 8e-50 BLAST
transmembrane domain 729 751 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107544
AA Change: D507G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103168
Gene: ENSMUSG00000038578
AA Change: D507G

DomainStartEndE-ValueType
EGF 28 76 2.02e-1 SMART
EGF_CA 77 127 2.22e-12 SMART
CCP 131 186 7.87e-9 SMART
CCP 191 246 5.48e-8 SMART
Blast:FN3 253 326 2e-6 BLAST
Blast:FN3 406 527 4e-50 BLAST
transmembrane domain 676 698 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T G 2: 165,078,944 E56D unknown Het
9930111J21Rik2 T C 11: 49,019,716 Q630R probably benign Het
Abca9 A G 11: 110,163,272 V68A probably benign Het
Acnat1 G A 4: 49,449,181 A195V possibly damaging Het
Acsl3 C T 1: 78,703,588 A612V probably benign Het
Adam12 A T 7: 133,998,232 D115E probably benign Het
Adam3 T A 8: 24,707,497 probably null Het
Aif1 G A 17: 35,172,624 probably benign Het
Ank3 A G 10: 69,988,309 D154G probably damaging Het
Arid3b A G 9: 57,810,159 C233R probably benign Het
Ccdc7b T A 8: 129,072,665 D74E unknown Het
Cckbr T A 7: 105,435,350 D430E probably benign Het
Chpf T C 1: 75,475,295 H667R probably benign Het
Dnah8 A G 17: 30,712,289 E1426G probably benign Het
Dync1h1 A G 12: 110,643,156 I2791V probably benign Het
Ehd3 A G 17: 73,816,392 N130S probably benign Het
Fam198b G A 3: 79,886,284 A20T probably benign Het
Fgfr4 A G 13: 55,159,151 T218A probably benign Het
Foxe1 G A 4: 46,344,599 E136K possibly damaging Het
Frmpd1 A G 4: 45,284,478 S1100G probably benign Het
Gm21886 T G 18: 80,089,757 Q62P probably null Het
Golga4 A G 9: 118,556,366 E852G probably damaging Het
Gprin3 T C 6: 59,353,711 D537G probably benign Het
Gpx5 C A 13: 21,288,748 D139Y probably damaging Het
Hmcn1 T C 1: 150,593,189 Y5007C probably damaging Het
Igsf10 G A 3: 59,328,411 R1450* probably null Het
Kif21a G A 15: 90,956,314 P1200S probably damaging Het
Kmt2c G A 5: 25,300,111 R3400C probably damaging Het
Miox A C 15: 89,336,539 M216L probably benign Het
Mphosph9 T C 5: 124,290,904 Y687C probably damaging Het
Mxi1 T A 19: 53,310,761 V21D probably benign Het
Nbeal1 T C 1: 60,260,432 L1309P probably benign Het
Olfr1116 A T 2: 87,269,077 T99S possibly damaging Het
Olfr1186 G A 2: 88,525,945 V121I probably benign Het
Olfr272 C T 4: 52,911,663 V44I probably benign Het
Olfr837 T C 9: 19,137,845 M284T possibly damaging Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Polq A G 16: 37,027,882 T284A probably damaging Het
Polrmt A T 10: 79,741,880 M295K probably damaging Het
Pou2af1 G T 9: 51,232,997 M70I probably damaging Het
Pou3f1 G A 4: 124,658,439 E245K probably damaging Het
Psmb1 C T 17: 15,494,486 V50I probably benign Het
Ptgis T C 2: 167,227,514 D50G probably damaging Het
R3hdm2 A G 10: 127,498,574 I955M probably benign Het
Rasef G A 4: 73,759,698 T97I probably benign Het
Rasef T C 4: 73,790,964 T11A probably benign Het
Sema4c C A 1: 36,549,914 L710F probably damaging Het
Slc39a10 C T 1: 46,812,168 A721T probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Spata31d1a A G 13: 59,700,325 C1330R possibly damaging Het
Tnfrsf1b T C 4: 145,229,090 Y32C probably damaging Het
Trhr2 C A 8: 122,357,344 V306F probably damaging Het
Trpm6 A T 19: 18,776,710 Q35L probably benign Het
Ttbk2 A G 2: 120,786,029 S197P probably damaging Het
Uggt2 T A 14: 119,042,647 E806D probably benign Het
Ushbp1 T G 8: 71,388,778 Q469P possibly damaging Het
Vmn1r73 G A 7: 11,757,109 V285I possibly damaging Het
Zfp934 A C 13: 62,520,189 S63R probably benign Het
Other mutations in Susd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:Susd1 APN 4 59365817 missense possibly damaging 0.85
IGL01705:Susd1 APN 4 59332931 splice site probably benign
IGL01727:Susd1 APN 4 59412329 splice site probably benign
IGL02015:Susd1 APN 4 59315745 missense possibly damaging 0.86
IGL02102:Susd1 APN 4 59369636 missense possibly damaging 0.70
IGL02351:Susd1 APN 4 59427985 nonsense probably null
IGL02358:Susd1 APN 4 59427985 nonsense probably null
IGL03210:Susd1 APN 4 59333035 critical splice acceptor site probably null
IGL03258:Susd1 APN 4 59379655 missense possibly damaging 0.73
R0612:Susd1 UTSW 4 59390561 splice site probably benign
R0719:Susd1 UTSW 4 59329506 missense possibly damaging 0.56
R0722:Susd1 UTSW 4 59379749 missense possibly damaging 0.73
R1355:Susd1 UTSW 4 59424114 missense possibly damaging 0.86
R1672:Susd1 UTSW 4 59411395 missense probably damaging 0.98
R1677:Susd1 UTSW 4 59424089 missense possibly damaging 0.85
R1921:Susd1 UTSW 4 59412191 missense probably benign 0.03
R1933:Susd1 UTSW 4 59351695 missense possibly damaging 0.72
R1998:Susd1 UTSW 4 59349925 missense probably benign 0.03
R2202:Susd1 UTSW 4 59349843 missense possibly damaging 0.96
R2203:Susd1 UTSW 4 59349843 missense possibly damaging 0.96
R2204:Susd1 UTSW 4 59349843 missense possibly damaging 0.96
R2329:Susd1 UTSW 4 59379715 missense possibly damaging 0.85
R2510:Susd1 UTSW 4 59349855 missense possibly damaging 0.86
R4512:Susd1 UTSW 4 59329491 missense possibly damaging 0.96
R4732:Susd1 UTSW 4 59428029 missense possibly damaging 0.53
R4733:Susd1 UTSW 4 59428029 missense possibly damaging 0.53
R4969:Susd1 UTSW 4 59351679 missense probably benign 0.04
R5121:Susd1 UTSW 4 59379657 missense possibly damaging 0.73
R5548:Susd1 UTSW 4 59369577 missense probably benign 0.05
R5747:Susd1 UTSW 4 59424108 missense probably damaging 0.98
R5776:Susd1 UTSW 4 59315363 utr 3 prime probably benign
R5875:Susd1 UTSW 4 59412203 missense possibly damaging 0.71
R6056:Susd1 UTSW 4 59379687 missense possibly damaging 0.53
R6081:Susd1 UTSW 4 59411359 missense possibly damaging 0.86
R7018:Susd1 UTSW 4 59390627 missense probably benign 0.44
R7122:Susd1 UTSW 4 59411318 nonsense probably null
R7161:Susd1 UTSW 4 59329581 missense possibly damaging 0.85
R7172:Susd1 UTSW 4 59315420 splice site probably null
R7974:Susd1 UTSW 4 59349915 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TTCCTTTACCATGACAGAAAGCAAC -3'
(R):5'- CCAGGGGCTGAGATTATAGTTATG -3'

Sequencing Primer
(F):5'- GAAAGCAACAATATTCCCTATCTGG -3'
(R):5'- AGAAGGCATTTGTCCAGG -3'
Posted On2019-12-20