Incidental Mutation 'R7891:Trhr2'
ID609336
Institutional Source Beutler Lab
Gene Symbol Trhr2
Ensembl Gene ENSMUSG00000039079
Gene Namethyrotropin releasing hormone receptor 2
SynonymsTRH-R2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R7891 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location122356967-122360746 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 122357344 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 306 (V306F)
Ref Sequence ENSEMBL: ENSMUSP00000042575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044123] [ENSMUST00000127664]
Predicted Effect probably damaging
Transcript: ENSMUST00000044123
AA Change: V306F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000042575
Gene: ENSMUSG00000039079
AA Change: V306F

DomainStartEndE-ValueType
Pfam:7tm_4 29 184 1e-12 PFAM
Pfam:7TM_GPCR_Srv 29 325 2e-7 PFAM
Pfam:7TM_GPCR_Srx 30 165 4.8e-7 PFAM
Pfam:7TM_GPCR_Srsx 33 323 5.6e-10 PFAM
Pfam:7tm_1 39 308 5.4e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T G 2: 165,078,944 E56D unknown Het
9930111J21Rik2 T C 11: 49,019,716 Q630R probably benign Het
Abca9 A G 11: 110,163,272 V68A probably benign Het
Acnat1 G A 4: 49,449,181 A195V possibly damaging Het
Acsl3 C T 1: 78,703,588 A612V probably benign Het
Adam12 A T 7: 133,998,232 D115E probably benign Het
Adam3 T A 8: 24,707,497 probably null Het
Aif1 G A 17: 35,172,624 probably benign Het
Ank3 A G 10: 69,988,309 D154G probably damaging Het
Arid3b A G 9: 57,810,159 C233R probably benign Het
Ccdc7b T A 8: 129,072,665 D74E unknown Het
Cckbr T A 7: 105,435,350 D430E probably benign Het
Chpf T C 1: 75,475,295 H667R probably benign Het
Dnah8 A G 17: 30,712,289 E1426G probably benign Het
Dync1h1 A G 12: 110,643,156 I2791V probably benign Het
Ehd3 A G 17: 73,816,392 N130S probably benign Het
Fam198b G A 3: 79,886,284 A20T probably benign Het
Fgfr4 A G 13: 55,159,151 T218A probably benign Het
Foxe1 G A 4: 46,344,599 E136K possibly damaging Het
Frmpd1 A G 4: 45,284,478 S1100G probably benign Het
Gm21886 T G 18: 80,089,757 Q62P probably null Het
Golga4 A G 9: 118,556,366 E852G probably damaging Het
Gprin3 T C 6: 59,353,711 D537G probably benign Het
Gpx5 C A 13: 21,288,748 D139Y probably damaging Het
Hmcn1 T C 1: 150,593,189 Y5007C probably damaging Het
Igsf10 G A 3: 59,328,411 R1450* probably null Het
Kif21a G A 15: 90,956,314 P1200S probably damaging Het
Kmt2c G A 5: 25,300,111 R3400C probably damaging Het
Miox A C 15: 89,336,539 M216L probably benign Het
Mphosph9 T C 5: 124,290,904 Y687C probably damaging Het
Mxi1 T A 19: 53,310,761 V21D probably benign Het
Nbeal1 T C 1: 60,260,432 L1309P probably benign Het
Olfr1116 A T 2: 87,269,077 T99S possibly damaging Het
Olfr1186 G A 2: 88,525,945 V121I probably benign Het
Olfr272 C T 4: 52,911,663 V44I probably benign Het
Olfr837 T C 9: 19,137,845 M284T possibly damaging Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Polq A G 16: 37,027,882 T284A probably damaging Het
Polrmt A T 10: 79,741,880 M295K probably damaging Het
Pou2af1 G T 9: 51,232,997 M70I probably damaging Het
Pou3f1 G A 4: 124,658,439 E245K probably damaging Het
Psmb1 C T 17: 15,494,486 V50I probably benign Het
Ptgis T C 2: 167,227,514 D50G probably damaging Het
R3hdm2 A G 10: 127,498,574 I955M probably benign Het
Rasef G A 4: 73,759,698 T97I probably benign Het
Rasef T C 4: 73,790,964 T11A probably benign Het
Sema4c C A 1: 36,549,914 L710F probably damaging Het
Slc39a10 C T 1: 46,812,168 A721T probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Spata31d1a A G 13: 59,700,325 C1330R possibly damaging Het
Susd1 T C 4: 59,349,915 D560G possibly damaging Het
Tnfrsf1b T C 4: 145,229,090 Y32C probably damaging Het
Trpm6 A T 19: 18,776,710 Q35L probably benign Het
Ttbk2 A G 2: 120,786,029 S197P probably damaging Het
Uggt2 T A 14: 119,042,647 E806D probably benign Het
Ushbp1 T G 8: 71,388,778 Q469P possibly damaging Het
Vmn1r73 G A 7: 11,757,109 V285I possibly damaging Het
Zfp934 A C 13: 62,520,189 S63R probably benign Het
Other mutations in Trhr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03070:Trhr2 APN 8 122358603 missense probably benign
IGL03387:Trhr2 APN 8 122358481 intron probably benign
IGL03408:Trhr2 APN 8 122358795 missense probably damaging 1.00
R0546:Trhr2 UTSW 8 122358489 critical splice donor site probably null
R1135:Trhr2 UTSW 8 122358633 missense probably damaging 1.00
R1377:Trhr2 UTSW 8 122360588 missense probably damaging 1.00
R1656:Trhr2 UTSW 8 122357446 missense probably damaging 1.00
R2055:Trhr2 UTSW 8 122358793 missense probably damaging 1.00
R4030:Trhr2 UTSW 8 122360699 start codon destroyed probably null 0.01
R4998:Trhr2 UTSW 8 122358772 missense probably benign 0.04
R5074:Trhr2 UTSW 8 122357371 missense probably benign 0.01
R6175:Trhr2 UTSW 8 122357379 missense probably damaging 0.99
R7048:Trhr2 UTSW 8 122358679 missense probably damaging 1.00
R7168:Trhr2 UTSW 8 122360537 missense probably damaging 1.00
R7185:Trhr2 UTSW 8 122360657 missense probably benign 0.26
R7284:Trhr2 UTSW 8 122360375 missense probably damaging 1.00
R7314:Trhr2 UTSW 8 122358750 missense possibly damaging 0.64
R7644:Trhr2 UTSW 8 122357322 missense possibly damaging 0.93
R7974:Trhr2 UTSW 8 122357344 missense probably damaging 0.99
Z1176:Trhr2 UTSW 8 122358795 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCTCAGAGCACACTGAAG -3'
(R):5'- TTACCTCTCTGTAGGCCACCAG -3'

Sequencing Primer
(F):5'- ACTGAAGTGGGGCTCATGC -3'
(R):5'- TCTGTAGGCCACCAGGATGC -3'
Posted On2019-12-20