Incidental Mutation 'R0138:Fmnl3'
ID60934
Institutional Source Beutler Lab
Gene Symbol Fmnl3
Ensembl Gene ENSMUSG00000023008
Gene Nameformin-like 3
SynonymsWbp3, 2700073B04Rik
MMRRC Submission 038423-MU
Accession Numbers

Genbank: NM_011711; MGI: 109569  

Is this an essential gene? Possibly essential (E-score: 0.740) question?
Stock #R0138 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location99317225-99370482 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to C at 99322738 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081224] [ENSMUST00000088233] [ENSMUST00000120633]
Predicted Effect probably benign
Transcript: ENSMUST00000081224
SMART Domains Protein: ENSMUSP00000079984
Gene: ENSMUSG00000023008

DomainStartEndE-ValueType
Drf_GBD 26 227 2.99e-88 SMART
Drf_FH3 230 421 6.1e-71 SMART
low complexity region 448 497 N/A INTRINSIC
FH2 510 944 9.85e-141 SMART
low complexity region 960 975 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088233
SMART Domains Protein: ENSMUSP00000085566
Gene: ENSMUSG00000023008

DomainStartEndE-ValueType
Drf_GBD 26 278 3.91e-92 SMART
Drf_FH3 281 472 6.1e-71 SMART
low complexity region 499 548 N/A INTRINSIC
FH2 561 995 9.85e-141 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120633
SMART Domains Protein: ENSMUSP00000113094
Gene: ENSMUSG00000023008

DomainStartEndE-ValueType
Drf_GBD 26 278 3.91e-92 SMART
Drf_FH3 281 472 6.1e-71 SMART
low complexity region 499 548 N/A INTRINSIC
FH2 561 995 9.85e-141 SMART
low complexity region 1011 1026 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139767
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a formin homology 2 domain and has high sequence identity to the mouse Wbp3 protein. Two alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,105,449 N693K probably damaging Het
Adgrl3 T A 5: 81,693,607 V845D probably damaging Het
Anxa8 T A 14: 34,097,939 F269Y probably benign Het
Anxa8 T A 14: 34,097,940 F295L possibly damaging Het
Aox4 C G 1: 58,228,866 L202V probably damaging Het
Ap3s2 A G 7: 79,909,869 V104A probably benign Het
Aqp3 G A 4: 41,094,843 probably benign Het
Arhgef26 C T 3: 62,448,259 H751Y probably benign Het
Asic4 A T 1: 75,469,687 Q291L possibly damaging Het
Bap1 T C 14: 31,256,724 Y31H probably damaging Het
Brf1 A T 12: 112,961,139 V655D probably damaging Het
Cebpz A G 17: 78,931,391 S663P probably benign Het
Ces2h A G 8: 105,018,061 D357G probably benign Het
Cfap36 T C 11: 29,244,073 T90A probably benign Het
Ciita A T 16: 10,512,270 D803V probably damaging Het
Clnk C A 5: 38,774,608 probably benign Het
Cyp46a1 A G 12: 108,351,211 N158S probably damaging Het
Cyp4f13 A G 17: 32,941,106 I98T possibly damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dll3 T A 7: 28,301,321 D103V possibly damaging Het
Dnaic1 T A 4: 41,629,814 M446K possibly damaging Het
Dppa4 A T 16: 48,291,062 T85S probably benign Het
Eif4g1 A T 16: 20,675,345 H57L probably damaging Het
Fn1 T A 1: 71,624,110 Q1073L possibly damaging Het
Foxp4 T C 17: 47,869,179 D599G unknown Het
Frrs1 T C 3: 116,881,807 V128A possibly damaging Het
Gcfc2 G A 6: 81,949,954 D608N probably damaging Het
Gm1043 T C 5: 37,192,973 probably benign Het
Gm5148 T C 3: 37,714,777 E98G probably benign Het
Gpr141 T C 13: 19,752,258 I116V probably benign Het
Hic1 T C 11: 75,167,343 N240S probably damaging Het
Hpx G A 7: 105,592,238 T322I probably damaging Het
Hs3st4 A T 7: 124,397,193 M361L probably benign Het
Ifrd1 A G 12: 40,207,130 probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Klk1b21 T A 7: 44,105,895 C173S probably damaging Het
Krt25 A T 11: 99,322,698 V65E probably benign Het
Lrrc15 A T 16: 30,273,449 D357E possibly damaging Het
Lrrd1 T A 5: 3,851,345 V550E probably benign Het
Macf1 A G 4: 123,440,747 Y1490H probably damaging Het
Macrod1 A G 19: 7,196,916 probably benign Het
Mcm5 T A 8: 75,120,880 V435D probably damaging Het
Mctp1 C T 13: 76,827,712 R478C probably damaging Het
Med10 T C 13: 69,811,698 probably benign Het
Mrpl4 T C 9: 21,008,592 Y280H probably benign Het
Msrb3 T C 10: 120,851,987 E61G probably damaging Het
Myo1c T C 11: 75,661,001 Y337H possibly damaging Het
Myo7b T A 18: 32,010,151 T165S probably damaging Het
Myrfl T A 10: 116,849,233 R81W probably damaging Het
Neil1 T C 9: 57,143,746 probably benign Het
Neto2 A G 8: 85,641,044 I357T possibly damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nkx6-3 T C 8: 23,153,591 S3P probably benign Het
Olfr652 A T 7: 104,565,003 I261L probably benign Het
Plce1 T C 19: 38,524,419 I54T possibly damaging Het
Prex2 A T 1: 11,285,043 probably benign Het
Psapl1 T A 5: 36,204,631 V189E probably damaging Het
Ptdss2 T G 7: 141,155,319 probably benign Het
Rnf213 T C 11: 119,416,496 C661R probably benign Het
Rpap1 T C 2: 119,764,899 probably null Het
Rrp1b A G 17: 32,060,452 T696A probably benign Het
Sacm1l T A 9: 123,548,917 H87Q probably benign Het
Serpinb11 T A 1: 107,377,530 M212K probably damaging Het
Tbc1d22a C A 15: 86,299,684 T248K probably damaging Het
Tcerg1 C T 18: 42,568,614 probably benign Het
Tpst1 T A 5: 130,101,786 H32Q probably damaging Het
Tsc2 A T 17: 24,599,626 V1412E possibly damaging Het
Usp19 C A 9: 108,501,315 P1326Q possibly damaging Het
Vmn1r235 T A 17: 21,262,334 M307K probably damaging Het
Vmn2r58 T A 7: 41,837,624 T616S probably damaging Het
Vps13a G A 19: 16,660,499 T2406I possibly damaging Het
Zbtb26 T A 2: 37,436,041 M328L probably benign Het
Zp2 A G 7: 120,137,200 F340S probably damaging Het
Other mutations in Fmnl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Fmnl3 APN 15 99322670 missense probably damaging 1.00
IGL00672:Fmnl3 APN 15 99325681 missense probably damaging 1.00
IGL00727:Fmnl3 APN 15 99322670 missense probably damaging 1.00
IGL00754:Fmnl3 APN 15 99322670 missense probably damaging 1.00
IGL00927:Fmnl3 APN 15 99337628 critical splice donor site probably null
IGL02376:Fmnl3 APN 15 99318963 missense possibly damaging 0.51
IGL02607:Fmnl3 APN 15 99324772 missense probably damaging 1.00
IGL03323:Fmnl3 APN 15 99321281 missense probably damaging 1.00
C9142:Fmnl3 UTSW 15 99337627 splice site probably null
PIT4280001:Fmnl3 UTSW 15 99321253 critical splice donor site probably null
R0003:Fmnl3 UTSW 15 99321132 missense probably damaging 0.99
R0003:Fmnl3 UTSW 15 99321132 missense probably damaging 0.99
R0116:Fmnl3 UTSW 15 99322738 splice site probably benign
R0117:Fmnl3 UTSW 15 99322738 splice site probably benign
R0137:Fmnl3 UTSW 15 99322738 splice site probably benign
R0701:Fmnl3 UTSW 15 99321307 missense probably damaging 0.99
R2338:Fmnl3 UTSW 15 99370227 missense probably benign 0.01
R3729:Fmnl3 UTSW 15 99321864 missense probably damaging 0.99
R4707:Fmnl3 UTSW 15 99323481 missense probably benign 0.00
R5346:Fmnl3 UTSW 15 99331990 missense probably damaging 1.00
R5655:Fmnl3 UTSW 15 99321862 missense probably damaging 0.99
R5916:Fmnl3 UTSW 15 99321828 missense probably damaging 0.99
R5951:Fmnl3 UTSW 15 99325910 missense probably damaging 1.00
R5954:Fmnl3 UTSW 15 99325910 missense probably damaging 1.00
R5957:Fmnl3 UTSW 15 99325910 missense probably damaging 1.00
R6334:Fmnl3 UTSW 15 99337653 missense probably damaging 1.00
R6891:Fmnl3 UTSW 15 99325873 missense probably damaging 1.00
R7182:Fmnl3 UTSW 15 99321782 missense probably damaging 0.99
R7423:Fmnl3 UTSW 15 99329400 missense probably damaging 0.99
X0009:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0010:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0011:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0012:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0014:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0017:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0021:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0023:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0023:Fmnl3 UTSW 15 99325284 missense probably damaging 1.00
X0028:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0033:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0060:Fmnl3 UTSW 15 99320038 missense possibly damaging 0.69
X0064:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0067:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTCTAAAGTCATCCCAGTCTCC -3'
(R):5'- AACTTGACCAGAGCTTCCATAGCAC -3'

Sequencing Primer
(F):5'- CACTGAAGACAGTGCCATTGATC -3'
(R):5'- ACTCTTCTCTGGGTCTCAAAGG -3'
Posted On2013-07-24