Incidental Mutation 'R7891:Dync1h1'
ID609348
Institutional Source Beutler Lab
Gene Symbol Dync1h1
Ensembl Gene ENSMUSG00000018707
Gene Namedynein cytoplasmic 1 heavy chain 1
Synonyms9930018I23Rik, Dnchc1, dynein heavy chain, retrograde transport, Swl, MAP1C, Loa, Dnec1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7891 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location110601452-110666945 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110643156 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 2791 (I2791V)
Ref Sequence ENSEMBL: ENSMUSP00000018851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018851]
PDB Structure
Microtubule binding domain from mouse cytoplasmic dynein as a fusion with seryl-tRNA synthetase [X-RAY DIFFRACTION]
High affinity dynein microtubule binding domain - tubulin complex [ELECTRON MICROSCOPY]
Low affinity dynein microtubule binding domain - tubulin complex [ELECTRON MICROSCOPY]
Structure of the entire stalk region of the dynein motor domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000018851
AA Change: I2791V

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000018851
Gene: ENSMUSG00000018707
AA Change: I2791V

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
Pfam:DHC_N1 237 830 1.9e-145 PFAM
coiled coil region 1171 1198 N/A INTRINSIC
Pfam:DHC_N2 1317 1721 3.3e-116 PFAM
AAA 1899 2043 5.39e-2 SMART
low complexity region 2102 2116 N/A INTRINSIC
AAA 2214 2365 2.13e0 SMART
low complexity region 2394 2405 N/A INTRINSIC
AAA 2585 2735 8.6e-7 SMART
Blast:AAA 2777 2811 2e-13 BLAST
AAA 2927 3093 4.79e-5 SMART
Pfam:MT 3197 3534 1.1e-44 PFAM
Pfam:AAA_9 3554 3778 8.5e-75 PFAM
Pfam:Dynein_heavy 3919 4642 4.3e-163 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are a group of microtubule-activated ATPases that function as molecular motors. They are divided into two subgroups of axonemal and cytoplasmic dyneins. The cytoplasmic dyneins function in intracellular motility, including retrograde axonal transport, protein sorting, organelle movement, and spindle dynamics. Molecules of conventional cytoplasmic dynein are comprised of 2 heavy chain polypeptides and a number of intermediate and light chains.This gene encodes a member of the cytoplasmic dynein heavy chain family. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for either the Cra1 or Loa ENU mutation exhibit neonatal lethality with reduced anterior horn cell number, abnormal motor neuron innervation, neuronal inclusions, and abnormal axonal transport. Heterozygotes display motor neuron degeneration and muscle spasms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T G 2: 165,078,944 E56D unknown Het
9930111J21Rik2 T C 11: 49,019,716 Q630R probably benign Het
Abca9 A G 11: 110,163,272 V68A probably benign Het
Acnat1 G A 4: 49,449,181 A195V possibly damaging Het
Acsl3 C T 1: 78,703,588 A612V probably benign Het
Adam12 A T 7: 133,998,232 D115E probably benign Het
Adam3 T A 8: 24,707,497 probably null Het
Aif1 G A 17: 35,172,624 probably benign Het
Ank3 A G 10: 69,988,309 D154G probably damaging Het
Arid3b A G 9: 57,810,159 C233R probably benign Het
Ccdc7b T A 8: 129,072,665 D74E unknown Het
Cckbr T A 7: 105,435,350 D430E probably benign Het
Chpf T C 1: 75,475,295 H667R probably benign Het
Dnah8 A G 17: 30,712,289 E1426G probably benign Het
Ehd3 A G 17: 73,816,392 N130S probably benign Het
Fam198b G A 3: 79,886,284 A20T probably benign Het
Fgfr4 A G 13: 55,159,151 T218A probably benign Het
Foxe1 G A 4: 46,344,599 E136K possibly damaging Het
Frmpd1 A G 4: 45,284,478 S1100G probably benign Het
Gm21886 T G 18: 80,089,757 Q62P probably null Het
Golga4 A G 9: 118,556,366 E852G probably damaging Het
Gprin3 T C 6: 59,353,711 D537G probably benign Het
Gpx5 C A 13: 21,288,748 D139Y probably damaging Het
Hmcn1 T C 1: 150,593,189 Y5007C probably damaging Het
Igsf10 G A 3: 59,328,411 R1450* probably null Het
Kif21a G A 15: 90,956,314 P1200S probably damaging Het
Kmt2c G A 5: 25,300,111 R3400C probably damaging Het
Miox A C 15: 89,336,539 M216L probably benign Het
Mphosph9 T C 5: 124,290,904 Y687C probably damaging Het
Mxi1 T A 19: 53,310,761 V21D probably benign Het
Nbeal1 T C 1: 60,260,432 L1309P probably benign Het
Olfr1116 A T 2: 87,269,077 T99S possibly damaging Het
Olfr1186 G A 2: 88,525,945 V121I probably benign Het
Olfr272 C T 4: 52,911,663 V44I probably benign Het
Olfr837 T C 9: 19,137,845 M284T possibly damaging Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Polq A G 16: 37,027,882 T284A probably damaging Het
Polrmt A T 10: 79,741,880 M295K probably damaging Het
Pou2af1 G T 9: 51,232,997 M70I probably damaging Het
Pou3f1 G A 4: 124,658,439 E245K probably damaging Het
Psmb1 C T 17: 15,494,486 V50I probably benign Het
Ptgis T C 2: 167,227,514 D50G probably damaging Het
R3hdm2 A G 10: 127,498,574 I955M probably benign Het
Rasef G A 4: 73,759,698 T97I probably benign Het
Rasef T C 4: 73,790,964 T11A probably benign Het
Sema4c C A 1: 36,549,914 L710F probably damaging Het
Slc39a10 C T 1: 46,812,168 A721T probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Spata31d1a A G 13: 59,700,325 C1330R possibly damaging Het
Susd1 T C 4: 59,349,915 D560G possibly damaging Het
Tnfrsf1b T C 4: 145,229,090 Y32C probably damaging Het
Trhr2 C A 8: 122,357,344 V306F probably damaging Het
Trpm6 A T 19: 18,776,710 Q35L probably benign Het
Ttbk2 A G 2: 120,786,029 S197P probably damaging Het
Uggt2 T A 14: 119,042,647 E806D probably benign Het
Ushbp1 T G 8: 71,388,778 Q469P possibly damaging Het
Vmn1r73 G A 7: 11,757,109 V285I possibly damaging Het
Zfp934 A C 13: 62,520,189 S63R probably benign Het
Other mutations in Dync1h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Dync1h1 APN 12 110649104 missense probably benign 0.31
IGL01299:Dync1h1 APN 12 110614107 missense probably benign 0.04
IGL01321:Dync1h1 APN 12 110625607 splice site probably benign
IGL01324:Dync1h1 APN 12 110626865 missense probably damaging 0.99
IGL01327:Dync1h1 APN 12 110616692 splice site probably benign
IGL01371:Dync1h1 APN 12 110638851 missense probably benign 0.05
IGL01598:Dync1h1 APN 12 110658128 missense probably damaging 0.99
IGL01782:Dync1h1 APN 12 110614940 missense probably damaging 1.00
IGL01791:Dync1h1 APN 12 110658930 missense probably damaging 0.99
IGL01797:Dync1h1 APN 12 110652196 critical splice donor site probably null
IGL02040:Dync1h1 APN 12 110637124 missense probably benign 0.21
IGL02096:Dync1h1 APN 12 110632820 missense possibly damaging 0.68
IGL02164:Dync1h1 APN 12 110662559 missense probably damaging 1.00
IGL02216:Dync1h1 APN 12 110663002 missense probably damaging 0.98
IGL02298:Dync1h1 APN 12 110640888 missense probably damaging 1.00
IGL02422:Dync1h1 APN 12 110640210 missense possibly damaging 0.68
IGL02610:Dync1h1 APN 12 110659232 nonsense probably null
IGL02643:Dync1h1 APN 12 110659272 unclassified probably benign
IGL03076:Dync1h1 APN 12 110657893 missense probably damaging 1.00
IGL03292:Dync1h1 APN 12 110666555 splice site probably null
IGL03293:Dync1h1 APN 12 110628734 missense probably benign 0.12
IGL03299:Dync1h1 APN 12 110619210 missense possibly damaging 0.49
chinashop UTSW 12 110658134 missense probably damaging 1.00
Gesund UTSW 12 110616404 missense probably benign 0.35
gymnast UTSW 12 110618368 missense probably damaging 1.00
Lightfoot UTSW 12 110617920 missense probably damaging 1.00
Lissom UTSW 12 110632820 missense possibly damaging 0.68
Strong UTSW 12 110658126 missense probably damaging 1.00
waters UTSW 12 110629679 missense probably damaging 1.00
ANU05:Dync1h1 UTSW 12 110649104 missense probably benign 0.31
H8562:Dync1h1 UTSW 12 110616807 missense probably benign 0.01
R0082:Dync1h1 UTSW 12 110636446 missense probably benign
R0110:Dync1h1 UTSW 12 110639944 missense probably benign 0.42
R0130:Dync1h1 UTSW 12 110618674 missense probably benign 0.16
R0233:Dync1h1 UTSW 12 110640980 missense probably benign 0.45
R0233:Dync1h1 UTSW 12 110640980 missense probably benign 0.45
R0242:Dync1h1 UTSW 12 110649851 missense possibly damaging 0.67
R0242:Dync1h1 UTSW 12 110649851 missense possibly damaging 0.67
R0408:Dync1h1 UTSW 12 110631692 missense probably benign
R0450:Dync1h1 UTSW 12 110639944 missense probably benign 0.42
R0611:Dync1h1 UTSW 12 110632788 missense probably damaging 0.97
R0612:Dync1h1 UTSW 12 110616496 missense probably damaging 1.00
R0624:Dync1h1 UTSW 12 110651747 unclassified probably benign
R0685:Dync1h1 UTSW 12 110657192 missense probably damaging 1.00
R0747:Dync1h1 UTSW 12 110612411 missense probably benign
R0747:Dync1h1 UTSW 12 110629284 missense probably damaging 0.99
R0843:Dync1h1 UTSW 12 110665213 missense possibly damaging 0.81
R0970:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1161:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1211:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1214:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1215:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1227:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1230:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1232:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1237:Dync1h1 UTSW 12 110665959 missense probably benign 0.00
R1274:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1275:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1289:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1290:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1331:Dync1h1 UTSW 12 110649264 missense probably damaging 0.98
R1340:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1383:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1394:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1396:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1397:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1413:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1432:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1500:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1661:Dync1h1 UTSW 12 110656357 missense probably damaging 1.00
R1678:Dync1h1 UTSW 12 110665662 critical splice acceptor site probably null
R1698:Dync1h1 UTSW 12 110626992 missense possibly damaging 0.88
R1767:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1776:Dync1h1 UTSW 12 110632928 splice site probably benign
R1812:Dync1h1 UTSW 12 110662900 missense possibly damaging 0.46
R1831:Dync1h1 UTSW 12 110614059 missense probably damaging 1.00
R1832:Dync1h1 UTSW 12 110614059 missense probably damaging 1.00
R1856:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1857:Dync1h1 UTSW 12 110662625 missense probably damaging 0.96
R1879:Dync1h1 UTSW 12 110624636 missense probably benign 0.04
R1892:Dync1h1 UTSW 12 110646304 missense probably damaging 1.00
R1909:Dync1h1 UTSW 12 110662629 missense probably damaging 1.00
R1962:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1974:Dync1h1 UTSW 12 110625732 missense possibly damaging 0.80
R1999:Dync1h1 UTSW 12 110666423 critical splice donor site probably null
R2073:Dync1h1 UTSW 12 110614592 missense probably damaging 1.00
R2091:Dync1h1 UTSW 12 110649588 missense probably benign 0.07
R2113:Dync1h1 UTSW 12 110629986 missense probably damaging 1.00
R2128:Dync1h1 UTSW 12 110640882 missense probably damaging 1.00
R2134:Dync1h1 UTSW 12 110656631 missense possibly damaging 0.68
R2496:Dync1h1 UTSW 12 110641220 missense possibly damaging 0.65
R2680:Dync1h1 UTSW 12 110643247 missense probably damaging 1.00
R2890:Dync1h1 UTSW 12 110616891 missense probably damaging 1.00
R2964:Dync1h1 UTSW 12 110641026 critical splice donor site probably null
R3705:Dync1h1 UTSW 12 110640586 missense possibly damaging 0.80
R3708:Dync1h1 UTSW 12 110643129 missense probably damaging 0.96
R3735:Dync1h1 UTSW 12 110631675 missense probably benign
R3736:Dync1h1 UTSW 12 110631675 missense probably benign
R3882:Dync1h1 UTSW 12 110629058 missense probably benign 0.41
R3971:Dync1h1 UTSW 12 110665965 missense probably benign 0.00
R4017:Dync1h1 UTSW 12 110643190 missense probably damaging 1.00
R4032:Dync1h1 UTSW 12 110618049 nonsense probably null
R4355:Dync1h1 UTSW 12 110632899 missense possibly damaging 0.55
R4514:Dync1h1 UTSW 12 110657139 missense possibly damaging 0.76
R4586:Dync1h1 UTSW 12 110649483 missense probably benign 0.30
R4619:Dync1h1 UTSW 12 110638844 missense probably benign 0.09
R4659:Dync1h1 UTSW 12 110628767 missense possibly damaging 0.50
R4676:Dync1h1 UTSW 12 110662541 missense probably damaging 0.99
R4688:Dync1h1 UTSW 12 110655528 missense probably damaging 0.99
R4732:Dync1h1 UTSW 12 110649507 nonsense probably null
R4733:Dync1h1 UTSW 12 110649507 nonsense probably null
R4780:Dync1h1 UTSW 12 110661196 missense probably damaging 1.00
R4846:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4861:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4861:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4865:Dync1h1 UTSW 12 110639801 missense possibly damaging 0.84
R4872:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4873:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4874:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4875:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4927:Dync1h1 UTSW 12 110662855 missense possibly damaging 0.82
R4949:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4954:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4956:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4957:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4958:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4984:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4985:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4988:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R5029:Dync1h1 UTSW 12 110618010 missense possibly damaging 0.46
R5032:Dync1h1 UTSW 12 110626892 nonsense probably null
R5036:Dync1h1 UTSW 12 110630535 missense probably damaging 1.00
R5037:Dync1h1 UTSW 12 110640907 missense probably benign 0.09
R5105:Dync1h1 UTSW 12 110617932 missense probably damaging 0.99
R5122:Dync1h1 UTSW 12 110629680 missense probably damaging 1.00
R5156:Dync1h1 UTSW 12 110628830 missense probably benign 0.00
R5290:Dync1h1 UTSW 12 110615068 missense probably benign 0.03
R5453:Dync1h1 UTSW 12 110632665 missense probably benign 0.12
R5540:Dync1h1 UTSW 12 110660950 missense probably benign 0.00
R5613:Dync1h1 UTSW 12 110632820 missense possibly damaging 0.68
R5626:Dync1h1 UTSW 12 110641141 missense probably benign 0.01
R5652:Dync1h1 UTSW 12 110665988 missense possibly damaging 0.70
R5655:Dync1h1 UTSW 12 110629062 missense probably benign 0.03
R5686:Dync1h1 UTSW 12 110616404 missense probably benign 0.35
R5772:Dync1h1 UTSW 12 110646273 nonsense probably null
R5806:Dync1h1 UTSW 12 110651653 missense probably damaging 1.00
R5891:Dync1h1 UTSW 12 110614220 critical splice donor site probably null
R5921:Dync1h1 UTSW 12 110618368 missense probably damaging 1.00
R5965:Dync1h1 UTSW 12 110632778 missense probably benign
R6113:Dync1h1 UTSW 12 110620414 missense probably benign
R6119:Dync1h1 UTSW 12 110628006 missense possibly damaging 0.82
R6154:Dync1h1 UTSW 12 110617993 missense probably damaging 1.00
R6339:Dync1h1 UTSW 12 110646205 missense probably damaging 0.97
R6522:Dync1h1 UTSW 12 110616737 missense probably damaging 0.99
R6531:Dync1h1 UTSW 12 110617920 missense probably damaging 1.00
R6554:Dync1h1 UTSW 12 110649848 missense probably benign 0.06
R6672:Dync1h1 UTSW 12 110658134 missense probably damaging 1.00
R6746:Dync1h1 UTSW 12 110651653 missense probably damaging 1.00
R6785:Dync1h1 UTSW 12 110629679 missense probably damaging 1.00
R6857:Dync1h1 UTSW 12 110658547 missense possibly damaging 0.94
R6863:Dync1h1 UTSW 12 110652180 missense probably benign 0.07
R6881:Dync1h1 UTSW 12 110624561 missense probably damaging 1.00
R6892:Dync1h1 UTSW 12 110638901 missense probably benign 0.00
R7015:Dync1h1 UTSW 12 110666087 nonsense probably null
R7096:Dync1h1 UTSW 12 110657078 missense probably damaging 0.99
R7173:Dync1h1 UTSW 12 110601739 missense probably benign
R7224:Dync1h1 UTSW 12 110617762 missense possibly damaging 0.93
R7295:Dync1h1 UTSW 12 110664749 critical splice donor site probably null
R7308:Dync1h1 UTSW 12 110665162 missense possibly damaging 0.91
R7346:Dync1h1 UTSW 12 110635642 missense probably damaging 1.00
R7359:Dync1h1 UTSW 12 110624602 missense probably benign 0.00
R7405:Dync1h1 UTSW 12 110634220 missense probably damaging 1.00
R7439:Dync1h1 UTSW 12 110636453 missense probably damaging 1.00
R7441:Dync1h1 UTSW 12 110636453 missense probably damaging 1.00
R7472:Dync1h1 UTSW 12 110665675 missense probably damaging 0.99
R7532:Dync1h1 UTSW 12 110651577 missense probably benign 0.00
R7543:Dync1h1 UTSW 12 110614107 missense probably benign 0.04
R7555:Dync1h1 UTSW 12 110630625 missense probably benign 0.03
R7632:Dync1h1 UTSW 12 110660893 missense probably benign 0.10
R7701:Dync1h1 UTSW 12 110618646 missense probably damaging 1.00
R7704:Dync1h1 UTSW 12 110665766 missense probably damaging 1.00
R7808:Dync1h1 UTSW 12 110655459 missense possibly damaging 0.53
R7895:Dync1h1 UTSW 12 110616457 missense probably damaging 1.00
R7913:Dync1h1 UTSW 12 110628734 missense probably benign 0.12
R8164:Dync1h1 UTSW 12 110616360 missense possibly damaging 0.91
R8257:Dync1h1 UTSW 12 110636474 missense probably damaging 1.00
R8346:Dync1h1 UTSW 12 110665792 missense probably benign 0.21
R8432:Dync1h1 UTSW 12 110618142 missense probably benign 0.00
R8510:Dync1h1 UTSW 12 110616743 missense possibly damaging 0.94
Z1088:Dync1h1 UTSW 12 110629917 frame shift probably null
Z1177:Dync1h1 UTSW 12 110637554 missense probably damaging 1.00
Z1177:Dync1h1 UTSW 12 110641177 frame shift probably null
Z1177:Dync1h1 UTSW 12 110658517 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTGGACGAGTGATCTAGC -3'
(R):5'- CTTGCAGATGCTGACAGGAC -3'

Sequencing Primer
(F):5'- TCCTGGACGAGTGATCTAGCAAAAAC -3'
(R):5'- TGCTGACAGGACCCCAGAATG -3'
Posted On2019-12-20