Incidental Mutation 'R7892:Clca3a1'
ID609376
Institutional Source Beutler Lab
Gene Symbol Clca3a1
Ensembl Gene ENSMUSG00000056025
Gene Namechloride channel accessory 3A1
SynonymsClca1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R7892 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location144729677-144760977 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144730818 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 835 (T835A)
Ref Sequence ENSEMBL: ENSMUSP00000054526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029932] [ENSMUST00000059091]
Predicted Effect probably benign
Transcript: ENSMUST00000029932
SMART Domains Protein: ENSMUSP00000029932
Gene: ENSMUSG00000056025

DomainStartEndE-ValueType
Pfam:CLCA_N 1 262 5.8e-144 PFAM
VWA 306 473 1.81e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059091
AA Change: T835A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000054526
Gene: ENSMUSG00000056025
AA Change: T835A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.44e-23 SMART
Blast:FN3 758 857 2e-44 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A G 16: 14,618,485 E134G Het
Acsm4 G A 7: 119,694,666 V87M possibly damaging Het
Adamts3 T C 5: 89,861,429 N125S probably benign Het
AI314180 T C 4: 58,828,593 I947V probably benign Het
Arhgef4 A G 1: 34,721,804 E47G unknown Het
BC067074 C T 13: 113,319,606 R729C Het
C1ra A G 6: 124,519,415 M367V probably benign Het
Ces2b T C 8: 104,832,753 W84R probably damaging Het
Cmya5 T C 13: 93,096,357 E741G probably damaging Het
D330020A13Rik T C 6: 120,294,858 L165P unknown Het
Dtnbp1 A T 13: 44,922,289 L326* probably null Het
Fat4 A T 3: 38,949,439 probably null Het
Fuom T A 7: 140,099,579 I143F unknown Het
Gm12569 G A 11: 51,234,786 E179K possibly damaging Het
Gm14444 A T 2: 175,016,731 M33L probably damaging Het
Gm21818 G T 13: 120,173,159 probably benign Het
Hmcn1 T C 1: 150,664,892 T2889A probably benign Het
Kif5b G A 18: 6,212,517 T769M probably benign Het
Kif9 G A 9: 110,514,614 R567H not run Het
Kmt2c A T 5: 25,299,816 M3498K probably benign Het
Lrrc29 A T 8: 105,315,533 I221N possibly damaging Het
Ly6e T A 15: 74,957,851 L15* probably null Het
Malt1 G A 18: 65,464,116 probably null Het
Mylk G C 16: 34,879,524 S419T probably benign Het
Oacyl T C 18: 65,737,847 L373P probably benign Het
Olfr1444 C T 19: 12,862,479 R235* probably null Het
Olfr1471 T A 19: 13,445,298 C95* probably null Het
Olfr32 T C 2: 90,138,492 I216V probably benign Het
Olfr959 A C 9: 39,572,549 S237A possibly damaging Het
Pcdh20 A T 14: 88,467,431 L811* probably null Het
Pgrmc2 A T 3: 41,082,980 D5E probably damaging Het
Pign A C 1: 105,657,676 F49L probably benign Het
Pip5k1b T C 19: 24,360,093 D277G probably benign Het
Ppm1m A G 9: 106,198,696 V11A probably benign Het
Prl7a1 A T 13: 27,633,678 V201E not run Het
Samhd1 A G 2: 157,116,495 S269P probably damaging Het
Sik2 A G 9: 51,008,832 V15A probably damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Sntg1 T C 1: 8,782,800 D42G probably damaging Het
Speg A T 1: 75,427,166 N2664Y probably damaging Het
Treh A G 9: 44,684,718 Y435C probably damaging Het
Trim59 A G 3: 69,037,807 S67P probably benign Het
Trim68 A T 7: 102,678,797 C309S unknown Het
Tubb4a G T 17: 57,080,880 S382* probably null Het
Vmn2r15 A T 5: 109,286,351 I829N probably damaging Het
Vmn2r68 T C 7: 85,234,514 T128A probably benign Het
Vmn2r70 T A 7: 85,559,380 I630L possibly damaging Het
Zc3hav1 A G 6: 38,329,221 I632T probably benign Het
Zfp558 A G 9: 18,468,697 S13P possibly damaging Het
Other mutations in Clca3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00768:Clca3a1 APN 3 144755251 missense probably damaging 0.96
IGL01331:Clca3a1 APN 3 144747512 missense probably damaging 1.00
IGL01895:Clca3a1 APN 3 144747572 nonsense probably null
IGL01940:Clca3a1 APN 3 144746976 missense probably benign 0.25
IGL02162:Clca3a1 APN 3 144754803 missense probably damaging 0.98
IGL02200:Clca3a1 APN 3 144751929 splice site probably benign
IGL03093:Clca3a1 APN 3 144747501 missense probably damaging 0.99
Lucha UTSW 3 144749689 missense probably damaging 1.00
R0256:Clca3a1 UTSW 3 144730879 missense probably damaging 0.98
R0513:Clca3a1 UTSW 3 144760562 critical splice donor site probably null
R0543:Clca3a1 UTSW 3 144748394 splice site probably benign
R1522:Clca3a1 UTSW 3 144755171 missense probably benign 0.01
R1744:Clca3a1 UTSW 3 144746835 missense probably damaging 0.99
R1873:Clca3a1 UTSW 3 144746829 missense probably damaging 0.99
R2238:Clca3a1 UTSW 3 144752005 missense possibly damaging 0.94
R2278:Clca3a1 UTSW 3 144758024 missense probably damaging 0.99
R2516:Clca3a1 UTSW 3 144737858 splice site probably null
R3737:Clca3a1 UTSW 3 144730721 missense probably benign 0.01
R3981:Clca3a1 UTSW 3 144755309 missense probably benign 0.00
R3982:Clca3a1 UTSW 3 144755309 missense probably benign 0.00
R3983:Clca3a1 UTSW 3 144755309 missense probably benign 0.00
R4038:Clca3a1 UTSW 3 144755233 missense probably benign 0.35
R4382:Clca3a1 UTSW 3 144760722 start codon destroyed probably benign 0.08
R4543:Clca3a1 UTSW 3 144746988 missense probably damaging 1.00
R4766:Clca3a1 UTSW 3 144749712 missense probably damaging 1.00
R4899:Clca3a1 UTSW 3 144737961 missense probably damaging 1.00
R5090:Clca3a1 UTSW 3 144737872 missense probably benign 0.01
R5091:Clca3a1 UTSW 3 144730722 missense probably benign 0.00
R5205:Clca3a1 UTSW 3 144746784 missense possibly damaging 0.68
R5248:Clca3a1 UTSW 3 144737136 missense possibly damaging 0.62
R5354:Clca3a1 UTSW 3 144737005 missense possibly damaging 0.77
R5871:Clca3a1 UTSW 3 144754881 missense probably damaging 1.00
R5907:Clca3a1 UTSW 3 144749642 intron probably benign
R5976:Clca3a1 UTSW 3 144746875 missense probably damaging 1.00
R6190:Clca3a1 UTSW 3 144758060 missense probably benign 0.40
R6193:Clca3a1 UTSW 3 144759232 missense possibly damaging 0.65
R6263:Clca3a1 UTSW 3 144749778 missense probably damaging 1.00
R6299:Clca3a1 UTSW 3 144758514 missense probably damaging 0.99
R6327:Clca3a1 UTSW 3 144730797 missense probably benign 0.02
R6497:Clca3a1 UTSW 3 144759259 missense possibly damaging 0.81
R6542:Clca3a1 UTSW 3 144759260 missense probably benign 0.01
R6547:Clca3a1 UTSW 3 144736947 missense probably damaging 1.00
R6759:Clca3a1 UTSW 3 144749689 missense probably damaging 1.00
R7032:Clca3a1 UTSW 3 144747568 missense probably benign 0.07
R7063:Clca3a1 UTSW 3 144755206 missense probably damaging 0.97
R7139:Clca3a1 UTSW 3 144755302 missense possibly damaging 0.58
R7638:Clca3a1 UTSW 3 144751962 missense probably damaging 1.00
R7663:Clca3a1 UTSW 3 144737036 missense probably benign 0.02
R7792:Clca3a1 UTSW 3 144749731 missense possibly damaging 0.95
R7798:Clca3a1 UTSW 3 144757962 missense probably damaging 1.00
R8096:Clca3a1 UTSW 3 144749685 missense probably damaging 1.00
R8305:Clca3a1 UTSW 3 144759166 splice site probably benign
R8416:Clca3a1 UTSW 3 144755153 critical splice donor site probably null
R8446:Clca3a1 UTSW 3 144748487 missense probably damaging 0.97
Z1088:Clca3a1 UTSW 3 144746953 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAAATTGTCATAGAGATTGCAG -3'
(R):5'- TGTCATGCACCACTCAGAGC -3'

Sequencing Primer
(F):5'- GATTGCAGAAATATCATCACCCAGTG -3'
(R):5'- TCAGAGCTTCCACACAGGTG -3'
Posted On2019-12-20