Incidental Mutation 'R7892:Adamts3'
ID 609379
Institutional Source Beutler Lab
Gene Symbol Adamts3
Ensembl Gene ENSMUSG00000043635
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 3
Synonyms 1100001H14Rik, 6330442E02Rik
MMRRC Submission 045944-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7892 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 89824946-90031193 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 90009288 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 125 (N125S)
Ref Sequence ENSEMBL: ENSMUSP00000132219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159] [ENSMUST00000198151]
AlphaFold E9Q287
Predicted Effect possibly damaging
Transcript: ENSMUST00000061427
AA Change: N125S

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: N125S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 42 201 5.1e-40 PFAM
Pfam:Reprolysin_5 254 439 5.4e-15 PFAM
Pfam:Reprolysin_4 256 454 1.9e-10 PFAM
Pfam:Reprolysin 257 460 3.6e-22 PFAM
Pfam:Reprolysin_2 274 451 7.7e-13 PFAM
Pfam:Reprolysin_3 278 409 1.5e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 827 3e-34 PFAM
TSP1 848 905 4.35e-2 SMART
TSP1 908 967 4.95e-2 SMART
TSP1 969 1016 6.58e-5 SMART
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1157 1177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163159
AA Change: N125S

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: N125S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 201 1.5e-40 PFAM
Pfam:Reprolysin_5 254 439 2.2e-15 PFAM
Pfam:Reprolysin_4 256 454 7.7e-11 PFAM
Pfam:Reprolysin 257 460 3.7e-21 PFAM
Pfam:Reprolysin_2 274 451 4.3e-14 PFAM
Pfam:Reprolysin_3 278 409 1.3e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 828 3.6e-28 PFAM
TSP1 849 906 4.35e-2 SMART
TSP1 909 968 4.95e-2 SMART
TSP1 970 1017 6.58e-5 SMART
low complexity region 1115 1129 N/A INTRINSIC
low complexity region 1158 1178 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198151
AA Change: N125S

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142771
Gene: ENSMUSG00000043635
AA Change: N125S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 42 174 2.3e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A G 16: 14,436,349 (GRCm39) E134G Het
Acsm4 G A 7: 119,293,889 (GRCm39) V87M possibly damaging Het
Arhgef4 A G 1: 34,760,885 (GRCm39) E47G unknown Het
C1ra A G 6: 124,496,374 (GRCm39) M367V probably benign Het
Ces2b T C 8: 105,559,385 (GRCm39) W84R probably damaging Het
Clca3a1 T C 3: 144,436,579 (GRCm39) T835A probably benign Het
Cmya5 T C 13: 93,232,865 (GRCm39) E741G probably damaging Het
Cspg4b C T 13: 113,456,140 (GRCm39) R729C Het
D330020A13Rik T C 6: 120,271,819 (GRCm39) L165P unknown Het
Dtnbp1 A T 13: 45,075,765 (GRCm39) L326* probably null Het
Ecpas T C 4: 58,828,593 (GRCm39) I947V probably benign Het
Fat4 A T 3: 39,003,588 (GRCm39) probably null Het
Fbxl9 A T 8: 106,042,165 (GRCm39) I221N possibly damaging Het
Fuom T A 7: 139,679,492 (GRCm39) I143F unknown Het
Gm14444 A T 2: 174,858,524 (GRCm39) M33L probably damaging Het
Hmcn1 T C 1: 150,540,643 (GRCm39) T2889A probably benign Het
Kif5b G A 18: 6,212,517 (GRCm39) T769M probably benign Het
Kif9 G A 9: 110,343,682 (GRCm39) R567H not run Het
Kmt2c A T 5: 25,504,814 (GRCm39) M3498K probably benign Het
Ly6e T A 15: 74,829,700 (GRCm39) L15* probably null Het
Malt1 G A 18: 65,597,187 (GRCm39) probably null Het
Msantd5 G A 11: 51,125,613 (GRCm39) E179K possibly damaging Het
Mylk G C 16: 34,699,894 (GRCm39) S419T probably benign Het
Oacyl T C 18: 65,870,918 (GRCm39) L373P probably benign Het
Or10d1 A C 9: 39,483,845 (GRCm39) S237A possibly damaging Het
Or4b1d T C 2: 89,968,836 (GRCm39) I216V probably benign Het
Or5b116 T A 19: 13,422,662 (GRCm39) C95* probably null Het
Or5b21 C T 19: 12,839,843 (GRCm39) R235* probably null Het
Pcdh20 A T 14: 88,704,867 (GRCm39) L811* probably null Het
Pgrmc2 A T 3: 41,037,415 (GRCm39) D5E probably damaging Het
Pign A C 1: 105,585,401 (GRCm39) F49L probably benign Het
Pip5k1b T C 19: 24,337,457 (GRCm39) D277G probably benign Het
Ppm1m A G 9: 106,075,895 (GRCm39) V11A probably benign Het
Prl7a1 A T 13: 27,817,661 (GRCm39) V201E not run Het
Samhd1 A G 2: 156,958,415 (GRCm39) S269P probably damaging Het
Sik2 A G 9: 50,920,132 (GRCm39) V15A probably damaging Het
Slc4a7 G A 14: 14,773,348 (GRCm38) E773K probably benign Het
Sntg1 T C 1: 8,853,024 (GRCm39) D42G probably damaging Het
Speg A T 1: 75,403,810 (GRCm39) N2664Y probably damaging Het
Tcstv1b G T 13: 120,634,695 (GRCm39) probably benign Het
Treh A G 9: 44,596,015 (GRCm39) Y435C probably damaging Het
Trim59 A G 3: 68,945,140 (GRCm39) S67P probably benign Het
Trim68 A T 7: 102,328,004 (GRCm39) C309S unknown Het
Tubb4a G T 17: 57,387,880 (GRCm39) S382* probably null Het
Vmn2r15 A T 5: 109,434,217 (GRCm39) I829N probably damaging Het
Vmn2r68 T C 7: 84,883,722 (GRCm39) T128A probably benign Het
Vmn2r70 T A 7: 85,208,588 (GRCm39) I630L possibly damaging Het
Zc3hav1 A G 6: 38,306,156 (GRCm39) I632T probably benign Het
Zfp558 A G 9: 18,379,993 (GRCm39) S13P possibly damaging Het
Other mutations in Adamts3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Adamts3 APN 5 90,009,184 (GRCm39) missense probably damaging 1.00
IGL00340:Adamts3 APN 5 89,849,525 (GRCm39) missense probably damaging 1.00
IGL00923:Adamts3 APN 5 89,832,235 (GRCm39) missense probably benign 0.06
IGL01420:Adamts3 APN 5 89,850,916 (GRCm39) missense possibly damaging 0.57
IGL01522:Adamts3 APN 5 89,850,802 (GRCm39) missense probably benign 0.14
IGL01676:Adamts3 APN 5 90,029,402 (GRCm39) missense possibly damaging 0.54
IGL01676:Adamts3 APN 5 89,825,613 (GRCm39) missense probably benign 0.00
IGL01678:Adamts3 APN 5 89,855,715 (GRCm39) missense probably damaging 1.00
IGL01936:Adamts3 APN 5 90,009,282 (GRCm39) missense probably benign 0.00
IGL01956:Adamts3 APN 5 89,825,770 (GRCm39) missense probably damaging 0.99
IGL02342:Adamts3 APN 5 89,839,332 (GRCm39) splice site probably null
IGL02415:Adamts3 APN 5 89,854,506 (GRCm39) splice site probably null
IGL03261:Adamts3 APN 5 90,030,756 (GRCm39) utr 5 prime probably benign
IGL03301:Adamts3 APN 5 89,855,263 (GRCm39) missense probably damaging 1.00
R0041:Adamts3 UTSW 5 89,832,326 (GRCm39) missense probably benign
R0079:Adamts3 UTSW 5 89,840,912 (GRCm39) missense probably benign 0.00
R0096:Adamts3 UTSW 5 89,849,576 (GRCm39) nonsense probably null
R0096:Adamts3 UTSW 5 89,849,576 (GRCm39) nonsense probably null
R0477:Adamts3 UTSW 5 89,832,366 (GRCm39) missense probably benign
R0605:Adamts3 UTSW 5 90,009,334 (GRCm39) missense possibly damaging 0.96
R1036:Adamts3 UTSW 5 89,843,952 (GRCm39) splice site probably benign
R1462:Adamts3 UTSW 5 90,009,208 (GRCm39) missense probably benign 0.17
R1462:Adamts3 UTSW 5 90,009,208 (GRCm39) missense probably benign 0.17
R1621:Adamts3 UTSW 5 89,869,560 (GRCm39) missense probably damaging 1.00
R1799:Adamts3 UTSW 5 89,923,280 (GRCm39) missense probably benign 0.00
R2163:Adamts3 UTSW 5 89,856,577 (GRCm39) missense probably damaging 0.99
R2412:Adamts3 UTSW 5 89,849,630 (GRCm39) missense probably damaging 0.99
R2420:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2421:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2422:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2921:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R2922:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R2923:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R3402:Adamts3 UTSW 5 89,849,592 (GRCm39) missense probably benign 0.04
R3431:Adamts3 UTSW 5 89,855,312 (GRCm39) splice site probably benign
R3432:Adamts3 UTSW 5 89,855,312 (GRCm39) splice site probably benign
R3813:Adamts3 UTSW 5 89,825,785 (GRCm39) missense possibly damaging 0.67
R3816:Adamts3 UTSW 5 89,853,123 (GRCm39) missense probably damaging 0.99
R3905:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3906:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3907:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3908:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R4557:Adamts3 UTSW 5 89,848,346 (GRCm39) missense probably benign 0.03
R4684:Adamts3 UTSW 5 89,850,866 (GRCm39) missense probably damaging 0.98
R4844:Adamts3 UTSW 5 89,825,675 (GRCm39) missense probably damaging 0.99
R4925:Adamts3 UTSW 5 89,832,182 (GRCm39) missense probably benign 0.01
R5097:Adamts3 UTSW 5 89,840,909 (GRCm39) missense probably damaging 0.97
R5100:Adamts3 UTSW 5 89,856,502 (GRCm39) missense probably damaging 1.00
R5237:Adamts3 UTSW 5 89,923,236 (GRCm39) missense probably benign
R5265:Adamts3 UTSW 5 90,009,411 (GRCm39) missense possibly damaging 0.91
R5322:Adamts3 UTSW 5 89,855,159 (GRCm39) splice site probably null
R5413:Adamts3 UTSW 5 89,856,626 (GRCm39) missense probably damaging 1.00
R5459:Adamts3 UTSW 5 89,839,332 (GRCm39) splice site probably null
R5738:Adamts3 UTSW 5 89,856,527 (GRCm39) missense probably damaging 1.00
R5979:Adamts3 UTSW 5 90,009,528 (GRCm39) missense probably damaging 0.96
R5992:Adamts3 UTSW 5 89,839,194 (GRCm39) missense probably damaging 1.00
R6364:Adamts3 UTSW 5 89,869,673 (GRCm39) missense possibly damaging 0.92
R6572:Adamts3 UTSW 5 90,009,468 (GRCm39) missense possibly damaging 0.87
R7098:Adamts3 UTSW 5 90,009,354 (GRCm39) missense probably damaging 1.00
R7172:Adamts3 UTSW 5 90,030,860 (GRCm39) start gained probably benign
R7263:Adamts3 UTSW 5 89,825,601 (GRCm39) missense probably benign 0.03
R7401:Adamts3 UTSW 5 89,855,309 (GRCm39) critical splice acceptor site probably null
R7599:Adamts3 UTSW 5 90,009,256 (GRCm39) missense probably benign 0.00
R7829:Adamts3 UTSW 5 90,009,349 (GRCm39) missense probably damaging 1.00
R7835:Adamts3 UTSW 5 89,848,299 (GRCm39) missense possibly damaging 0.70
R8021:Adamts3 UTSW 5 89,831,043 (GRCm39) missense possibly damaging 0.47
R8289:Adamts3 UTSW 5 89,923,282 (GRCm39) missense possibly damaging 0.89
R8350:Adamts3 UTSW 5 89,850,815 (GRCm39) missense probably damaging 1.00
R8468:Adamts3 UTSW 5 89,842,627 (GRCm39) missense probably benign 0.19
R8827:Adamts3 UTSW 5 89,839,324 (GRCm39) missense probably benign 0.03
R8864:Adamts3 UTSW 5 89,854,981 (GRCm39) intron probably benign
R8906:Adamts3 UTSW 5 89,825,575 (GRCm39) missense probably damaging 0.98
R9000:Adamts3 UTSW 5 89,854,570 (GRCm39) missense probably benign 0.17
R9005:Adamts3 UTSW 5 89,825,693 (GRCm39) missense probably benign 0.08
R9378:Adamts3 UTSW 5 89,848,269 (GRCm39) nonsense probably null
R9505:Adamts3 UTSW 5 89,855,751 (GRCm39) missense probably damaging 1.00
R9516:Adamts3 UTSW 5 89,834,750 (GRCm39) missense probably damaging 1.00
X0064:Adamts3 UTSW 5 89,850,901 (GRCm39) missense possibly damaging 0.75
Z1088:Adamts3 UTSW 5 89,832,308 (GRCm39) missense probably damaging 0.99
Z1176:Adamts3 UTSW 5 89,923,210 (GRCm39) missense not run
Z1177:Adamts3 UTSW 5 89,923,210 (GRCm39) missense not run
Z1177:Adamts3 UTSW 5 89,855,723 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACCCTTCCATGTTCATACAGG -3'
(R):5'- TGACACCAGTTAGCACGAATC -3'

Sequencing Primer
(F):5'- CCTTCCATGTTCATACAGGAAAGG -3'
(R):5'- CCAGTTAGCACGAATCTAAAAGG -3'
Posted On 2019-12-20