Mutagenetix > Incidental Mutation

Incidental Mutation 'R7892:Adamts3'

609379

Institutional Source

Beutler Lab

Gene Symbol

Adamts3

Ensembl Gene

ENSMUSG00000043635

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3

Synonyms

6330442E02Rik, 1100001H14Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7892 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

89677087-89883334 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 89861429 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 125 (N125S)

Ref Sequence

ENSEMBL: ENSMUSP00000132219 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159] [ENSMUST00000198151]

AlphaFold

E9Q287

Predicted Effect

possibly damaging
Transcript: ENSMUST00000061427
AA Change: N125S

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: N125S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	42	201	5.1e-40	PFAM
Pfam:Reprolysin_5	254	439	5.4e-15	PFAM
Pfam:Reprolysin_4	256	454	1.9e-10	PFAM
Pfam:Reprolysin	257	460	3.6e-22	PFAM
Pfam:Reprolysin_2	274	451	7.7e-13	PFAM
Pfam:Reprolysin_3	278	409	1.5e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	827	3e-34	PFAM
TSP1	848	905	4.35e-2	SMART
TSP1	908	967	4.95e-2	SMART
TSP1	969	1016	6.58e-5	SMART
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1157	1177	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163159
AA Change: N125S

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: N125S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	43	201	1.5e-40	PFAM
Pfam:Reprolysin_5	254	439	2.2e-15	PFAM
Pfam:Reprolysin_4	256	454	7.7e-11	PFAM
Pfam:Reprolysin	257	460	3.7e-21	PFAM
Pfam:Reprolysin_2	274	451	4.3e-14	PFAM
Pfam:Reprolysin_3	278	409	1.3e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	828	3.6e-28	PFAM
TSP1	849	906	4.35e-2	SMART
TSP1	909	968	4.95e-2	SMART
TSP1	970	1017	6.58e-5	SMART
low complexity region	1115	1129	N/A	INTRINSIC
low complexity region	1158	1178	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000198151
AA Change: N125S

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000142771
Gene: ENSMUSG00000043635
AA Change: N125S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	42	174	2.3e-29	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630010A05Rik	A	G	16: 14,618,485	E134G		Het
Acsm4	G	A	7: 119,694,666	V87M	possibly damaging	Het
AI314180	T	C	4: 58,828,593	I947V	probably benign	Het
Arhgef4	A	G	1: 34,721,804	E47G	unknown	Het
BC067074	C	T	13: 113,319,606	R729C		Het
C1ra	A	G	6: 124,519,415	M367V	probably benign	Het
Ces2b	T	C	8: 104,832,753	W84R	probably damaging	Het
Clca3a1	T	C	3: 144,730,818	T835A	probably benign	Het
Cmya5	T	C	13: 93,096,357	E741G	probably damaging	Het
D330020A13Rik	T	C	6: 120,294,858	L165P	unknown	Het
Dtnbp1	A	T	13: 44,922,289	L326*	probably null	Het
Fat4	A	T	3: 38,949,439		probably null	Het
Fuom	T	A	7: 140,099,579	I143F	unknown	Het
Gm12569	G	A	11: 51,234,786	E179K	possibly damaging	Het
Gm14444	A	T	2: 175,016,731	M33L	probably damaging	Het
Gm21818	G	T	13: 120,173,159		probably benign	Het
Hmcn1	T	C	1: 150,664,892	T2889A	probably benign	Het
Kif5b	G	A	18: 6,212,517	T769M	probably benign	Het
Kif9	G	A	9: 110,514,614	R567H	not run	Het
Kmt2c	A	T	5: 25,299,816	M3498K	probably benign	Het
Lrrc29	A	T	8: 105,315,533	I221N	possibly damaging	Het
Ly6e	T	A	15: 74,957,851	L15*	probably null	Het
Malt1	G	A	18: 65,464,116		probably null	Het
Mylk	G	C	16: 34,879,524	S419T	probably benign	Het
Oacyl	T	C	18: 65,737,847	L373P	probably benign	Het
Olfr1444	C	T	19: 12,862,479	R235*	probably null	Het
Olfr1471	T	A	19: 13,445,298	C95*	probably null	Het
Olfr32	T	C	2: 90,138,492	I216V	probably benign	Het
Olfr959	A	C	9: 39,572,549	S237A	possibly damaging	Het
Pcdh20	A	T	14: 88,467,431	L811*	probably null	Het
Pgrmc2	A	T	3: 41,082,980	D5E	probably damaging	Het
Pign	A	C	1: 105,657,676	F49L	probably benign	Het
Pip5k1b	T	C	19: 24,360,093	D277G	probably benign	Het
Ppm1m	A	G	9: 106,198,696	V11A	probably benign	Het
Prl7a1	A	T	13: 27,633,678	V201E	not run	Het
Samhd1	A	G	2: 157,116,495	S269P	probably damaging	Het
Sik2	A	G	9: 51,008,832	V15A	probably damaging	Het
Slc4a7	G	A	14: 14,773,348	E773K	probably benign	Het
Sntg1	T	C	1: 8,782,800	D42G	probably damaging	Het
Speg	A	T	1: 75,427,166	N2664Y	probably damaging	Het
Treh	A	G	9: 44,684,718	Y435C	probably damaging	Het
Trim59	A	G	3: 69,037,807	S67P	probably benign	Het
Trim68	A	T	7: 102,678,797	C309S	unknown	Het
Tubb4a	G	T	17: 57,080,880	S382*	probably null	Het
Vmn2r15	A	T	5: 109,286,351	I829N	probably damaging	Het
Vmn2r68	T	C	7: 85,234,514	T128A	probably benign	Het
Vmn2r70	T	A	7: 85,559,380	I630L	possibly damaging	Het
Zc3hav1	A	G	6: 38,329,221	I632T	probably benign	Het
Zfp558	A	G	9: 18,468,697	S13P	possibly damaging	Het

Other mutations in Adamts3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Adamts3	APN	5	89861325	missense	probably damaging	1.00
IGL00340:Adamts3	APN	5	89701666	missense	probably damaging	1.00
IGL00923:Adamts3	APN	5	89684376	missense	probably benign	0.06
IGL01420:Adamts3	APN	5	89703057	missense	possibly damaging	0.57
IGL01522:Adamts3	APN	5	89702943	missense	probably benign	0.14
IGL01676:Adamts3	APN	5	89677754	missense	probably benign	0.00
IGL01676:Adamts3	APN	5	89881543	missense	possibly damaging	0.54
IGL01678:Adamts3	APN	5	89707856	missense	probably damaging	1.00
IGL01936:Adamts3	APN	5	89861423	missense	probably benign	0.00
IGL01956:Adamts3	APN	5	89677911	missense	probably damaging	0.99
IGL02342:Adamts3	APN	5	89691473	splice site	probably null
IGL02415:Adamts3	APN	5	89706647	splice site	probably null
IGL03261:Adamts3	APN	5	89882897	utr 5 prime	probably benign
IGL03301:Adamts3	APN	5	89707404	missense	probably damaging	1.00
R0041:Adamts3	UTSW	5	89684467	missense	probably benign
R0079:Adamts3	UTSW	5	89693053	missense	probably benign	0.00
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0477:Adamts3	UTSW	5	89684507	missense	probably benign
R0605:Adamts3	UTSW	5	89861475	missense	possibly damaging	0.96
R1036:Adamts3	UTSW	5	89696093	splice site	probably benign
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1621:Adamts3	UTSW	5	89721701	missense	probably damaging	1.00
R1799:Adamts3	UTSW	5	89775421	missense	probably benign	0.00
R2163:Adamts3	UTSW	5	89708718	missense	probably damaging	0.99
R2412:Adamts3	UTSW	5	89701771	missense	probably damaging	0.99
R2420:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2421:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2422:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2921:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2922:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2923:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R3402:Adamts3	UTSW	5	89701733	missense	probably benign	0.04
R3431:Adamts3	UTSW	5	89707453	splice site	probably benign
R3432:Adamts3	UTSW	5	89707453	splice site	probably benign
R3813:Adamts3	UTSW	5	89677926	missense	possibly damaging	0.67
R3816:Adamts3	UTSW	5	89705264	missense	probably damaging	0.99
R3905:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3906:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3907:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3908:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R4557:Adamts3	UTSW	5	89700487	missense	probably benign	0.03
R4684:Adamts3	UTSW	5	89703007	missense	probably damaging	0.98
R4844:Adamts3	UTSW	5	89677816	missense	probably damaging	0.99
R4925:Adamts3	UTSW	5	89684323	missense	probably benign	0.01
R5097:Adamts3	UTSW	5	89693050	missense	probably damaging	0.97
R5100:Adamts3	UTSW	5	89708643	missense	probably damaging	1.00
R5237:Adamts3	UTSW	5	89775377	missense	probably benign
R5265:Adamts3	UTSW	5	89861552	missense	possibly damaging	0.91
R5322:Adamts3	UTSW	5	89707300	splice site	probably null
R5413:Adamts3	UTSW	5	89708767	missense	probably damaging	1.00
R5459:Adamts3	UTSW	5	89691473	splice site	probably null
R5738:Adamts3	UTSW	5	89708668	missense	probably damaging	1.00
R5979:Adamts3	UTSW	5	89861669	missense	probably damaging	0.96
R5992:Adamts3	UTSW	5	89691335	missense	probably damaging	1.00
R6364:Adamts3	UTSW	5	89721814	missense	possibly damaging	0.92
R6572:Adamts3	UTSW	5	89861609	missense	possibly damaging	0.87
R7098:Adamts3	UTSW	5	89861495	missense	probably damaging	1.00
R7172:Adamts3	UTSW	5	89883001	start gained	probably benign
R7263:Adamts3	UTSW	5	89677742	missense	probably benign	0.03
R7401:Adamts3	UTSW	5	89707450	critical splice acceptor site	probably null
R7599:Adamts3	UTSW	5	89861397	missense	probably benign	0.00
R7829:Adamts3	UTSW	5	89861490	missense	probably damaging	1.00
R7835:Adamts3	UTSW	5	89700440	missense	possibly damaging	0.70
R8021:Adamts3	UTSW	5	89683184	missense	possibly damaging	0.47
R8289:Adamts3	UTSW	5	89775423	missense	possibly damaging	0.89
R8350:Adamts3	UTSW	5	89702956	missense	probably damaging	1.00
R8468:Adamts3	UTSW	5	89694768	missense	probably benign	0.19
R8827:Adamts3	UTSW	5	89691465	missense	probably benign	0.03
R8864:Adamts3	UTSW	5	89707122	intron	probably benign
R8906:Adamts3	UTSW	5	89677716	missense	probably damaging	0.98
R9000:Adamts3	UTSW	5	89706711	missense	probably benign	0.17
R9005:Adamts3	UTSW	5	89677834	missense	probably benign	0.08
R9378:Adamts3	UTSW	5	89700410	nonsense	probably null
R9505:Adamts3	UTSW	5	89707892	missense	probably damaging	1.00
R9516:Adamts3	UTSW	5	89686891	missense	probably damaging	1.00
X0064:Adamts3	UTSW	5	89703042	missense	possibly damaging	0.75
Z1088:Adamts3	UTSW	5	89684449	missense	probably damaging	0.99
Z1176:Adamts3	UTSW	5	89775351	missense	not run
Z1177:Adamts3	UTSW	5	89707864	nonsense	probably null
Z1177:Adamts3	UTSW	5	89775351	missense	not run

Predicted Primers

PCR Primer
(F):5'- CACCCTTCCATGTTCATACAGG -3'
(R):5'- TGACACCAGTTAGCACGAATC -3'

Sequencing Primer
(F):5'- CCTTCCATGTTCATACAGGAAAGG -3'
(R):5'- CCAGTTAGCACGAATCTAAAAGG -3'

Posted On

2019-12-20