Mutagenetix > Incidental Mutations

Incidental Mutation 'R7892:Vmn2r15'

609380

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r15

Ensembl Gene

ENSMUSG00000091375

Gene Name

vomeronasal 2, receptor 15

Synonyms

EG211223

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R7892 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

109286269-109297556 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 109286351 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 829 (I829N)

Ref Sequence

ENSEMBL: ENSMUSP00000128333 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167133]

Predicted Effect

probably damaging
Transcript: ENSMUST00000167133
AA Change: I829N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128333
Gene: ENSMUSG00000091375
AA Change: I829N

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:ANF_receptor	75	472	1e-29	PFAM
Pfam:NCD3G	514	568	5.8e-18	PFAM
Pfam:7tm_3	601	836	9.1e-55	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630010A05Rik	A	G	16: 14,618,485	E134G		Het
Acsm4	G	A	7: 119,694,666	V87M	possibly damaging	Het
Adamts3	T	C	5: 89,861,429	N125S	probably benign	Het
AI314180	T	C	4: 58,828,593	I947V	probably benign	Het
Arhgef4	A	G	1: 34,721,804	E47G	unknown	Het
BC067074	C	T	13: 113,319,606	R729C		Het
C1ra	A	G	6: 124,519,415	M367V	probably benign	Het
Ces2b	T	C	8: 104,832,753	W84R	probably damaging	Het
Clca3a1	T	C	3: 144,730,818	T835A	probably benign	Het
Cmya5	T	C	13: 93,096,357	E741G	probably damaging	Het
D330020A13Rik	T	C	6: 120,294,858	L165P	unknown	Het
Dtnbp1	A	T	13: 44,922,289	L326*	probably null	Het
Fat4	A	T	3: 38,949,439		probably null	Het
Fuom	T	A	7: 140,099,579	I143F	unknown	Het
Gm12569	G	A	11: 51,234,786	E179K	possibly damaging	Het
Gm14444	A	T	2: 175,016,731	M33L	probably damaging	Het
Gm21818	G	T	13: 120,173,159		probably benign	Het
Hmcn1	T	C	1: 150,664,892	T2889A	probably benign	Het
Kif5b	G	A	18: 6,212,517	T769M	probably benign	Het
Kif9	G	A	9: 110,514,614	R567H	not run	Het
Kmt2c	A	T	5: 25,299,816	M3498K	probably benign	Het
Lrrc29	A	T	8: 105,315,533	I221N	possibly damaging	Het
Ly6e	T	A	15: 74,957,851	L15*	probably null	Het
Malt1	G	A	18: 65,464,116		probably null	Het
Mylk	G	C	16: 34,879,524	S419T	probably benign	Het
Oacyl	T	C	18: 65,737,847	L373P	probably benign	Het
Olfr1444	C	T	19: 12,862,479	R235*	probably null	Het
Olfr1471	T	A	19: 13,445,298	C95*	probably null	Het
Olfr32	T	C	2: 90,138,492	I216V	probably benign	Het
Olfr959	A	C	9: 39,572,549	S237A	possibly damaging	Het
Pcdh20	A	T	14: 88,467,431	L811*	probably null	Het
Pgrmc2	A	T	3: 41,082,980	D5E	probably damaging	Het
Pign	A	C	1: 105,657,676	F49L	probably benign	Het
Pip5k1b	T	C	19: 24,360,093	D277G	probably benign	Het
Ppm1m	A	G	9: 106,198,696	V11A	probably benign	Het
Prl7a1	A	T	13: 27,633,678	V201E	not run	Het
Samhd1	A	G	2: 157,116,495	S269P	probably damaging	Het
Sik2	A	G	9: 51,008,832	V15A	probably damaging	Het
Slc4a7	G	A	14: 14,773,348	E773K	probably benign	Het
Sntg1	T	C	1: 8,782,800	D42G	probably damaging	Het
Speg	A	T	1: 75,427,166	N2664Y	probably damaging	Het
Treh	A	G	9: 44,684,718	Y435C	probably damaging	Het
Trim59	A	G	3: 69,037,807	S67P	probably benign	Het
Trim68	A	T	7: 102,678,797	C309S	unknown	Het
Tubb4a	G	T	17: 57,080,880	S382*	probably null	Het
Vmn2r68	T	C	7: 85,234,514	T128A	probably benign	Het
Vmn2r70	T	A	7: 85,559,380	I630L	possibly damaging	Het
Zc3hav1	A	G	6: 38,329,221	I632T	probably benign	Het
Zfp558	A	G	9: 18,468,697	S13P	possibly damaging	Het

Other mutations in Vmn2r15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01335:Vmn2r15	APN	5	109286736	missense	possibly damaging	0.70
IGL01367:Vmn2r15	APN	5	109293209	missense	probably damaging	0.99
IGL01844:Vmn2r15	APN	5	109286269	makesense	probably null
IGL02190:Vmn2r15	APN	5	109293374	missense	probably damaging	1.00
IGL02754:Vmn2r15	APN	5	109293268	nonsense	probably null
IGL02797:Vmn2r15	APN	5	109297384	missense	probably benign	0.18
IGL03301:Vmn2r15	APN	5	109297355	critical splice donor site	probably null
IGL03407:Vmn2r15	APN	5	109286319	nonsense	probably null
BB001:Vmn2r15	UTSW	5	109286388	missense	probably damaging	1.00
BB011:Vmn2r15	UTSW	5	109286388	missense	probably damaging	1.00
PIT4445001:Vmn2r15	UTSW	5	109287142	missense	probably damaging	0.99
PIT4520001:Vmn2r15	UTSW	5	109287005	missense	probably damaging	1.00
R0038:Vmn2r15	UTSW	5	109293144	missense	possibly damaging	0.46
R0111:Vmn2r15	UTSW	5	109287156	missense	possibly damaging	0.56
R0379:Vmn2r15	UTSW	5	109286478	missense	probably damaging	1.00
R0427:Vmn2r15	UTSW	5	109287087	missense	probably damaging	1.00
R0639:Vmn2r15	UTSW	5	109293015	missense	probably benign	0.22
R0964:Vmn2r15	UTSW	5	109297535	missense	probably benign	0.34
R1147:Vmn2r15	UTSW	5	109293206	missense	probably damaging	1.00
R1147:Vmn2r15	UTSW	5	109293206	missense	probably damaging	1.00
R1232:Vmn2r15	UTSW	5	109293302	missense	probably benign	0.39
R1241:Vmn2r15	UTSW	5	109292904	missense	probably damaging	1.00
R1244:Vmn2r15	UTSW	5	109293226	nonsense	probably null
R1394:Vmn2r15	UTSW	5	109294148	missense	probably benign	0.44
R1395:Vmn2r15	UTSW	5	109294148	missense	probably benign	0.44
R1423:Vmn2r15	UTSW	5	109293227	missense	probably damaging	1.00
R1439:Vmn2r15	UTSW	5	109294087	missense	probably damaging	1.00
R1513:Vmn2r15	UTSW	5	109293329	missense	probably damaging	1.00
R1777:Vmn2r15	UTSW	5	109294270	missense	possibly damaging	0.79
R1844:Vmn2r15	UTSW	5	109286994	nonsense	probably null
R2072:Vmn2r15	UTSW	5	109286753	missense	possibly damaging	0.65
R2074:Vmn2r15	UTSW	5	109286753	missense	possibly damaging	0.65
R2122:Vmn2r15	UTSW	5	109286456	missense	probably damaging	1.00
R2208:Vmn2r15	UTSW	5	109297443	missense	possibly damaging	0.64
R2268:Vmn2r15	UTSW	5	109293207	missense	probably benign	0.31
R2831:Vmn2r15	UTSW	5	109286592	missense	probably damaging	1.00
R3848:Vmn2r15	UTSW	5	109297446	missense	probably benign	0.00
R4058:Vmn2r15	UTSW	5	109293446	missense	probably damaging	0.99
R4615:Vmn2r15	UTSW	5	109293482	missense	possibly damaging	0.91
R4663:Vmn2r15	UTSW	5	109294074	missense	probably benign
R4681:Vmn2r15	UTSW	5	109286622	missense	probably damaging	0.97
R4751:Vmn2r15	UTSW	5	109286754	missense	probably benign	0.01
R5095:Vmn2r15	UTSW	5	109288451	critical splice acceptor site	probably null
R5300:Vmn2r15	UTSW	5	109294108	missense	probably damaging	0.99
R5309:Vmn2r15	UTSW	5	109293090	missense	probably damaging	0.99
R5335:Vmn2r15	UTSW	5	109286807	missense	probably damaging	0.99
R5421:Vmn2r15	UTSW	5	109286535	missense	probably damaging	1.00
R5805:Vmn2r15	UTSW	5	109286940	missense	possibly damaging	0.88
R6280:Vmn2r15	UTSW	5	109293425	missense	possibly damaging	0.65
R6324:Vmn2r15	UTSW	5	109286271	makesense	probably null
R6383:Vmn2r15	UTSW	5	109293226	nonsense	probably null
R6772:Vmn2r15	UTSW	5	109286372	missense	probably damaging	0.99
R6991:Vmn2r15	UTSW	5	109293314	missense	probably damaging	1.00
R7194:Vmn2r15	UTSW	5	109292783	missense	probably damaging	1.00
R7365:Vmn2r15	UTSW	5	109293239	missense	probably benign	0.19
R7365:Vmn2r15	UTSW	5	109297522	missense	probably benign	0.15
R7423:Vmn2r15	UTSW	5	109297528	missense	probably benign	0.00
R7552:Vmn2r15	UTSW	5	109292908	nonsense	probably null
R7619:Vmn2r15	UTSW	5	109288324	critical splice donor site	probably null
R7924:Vmn2r15	UTSW	5	109286388	missense	probably damaging	1.00
R8058:Vmn2r15	UTSW	5	109293090	missense	probably damaging	0.99
R8099:Vmn2r15	UTSW	5	109293319	missense	possibly damaging	0.58
R8189:Vmn2r15	UTSW	5	109286847	missense	probably benign	0.02
R8275:Vmn2r15	UTSW	5	109286284	missense	probably benign	0.08
R8277:Vmn2r15	UTSW	5	109293104	missense	probably benign	0.00
R8277:Vmn2r15	UTSW	5	109293444	missense	probably damaging	1.00
R8465:Vmn2r15	UTSW	5	109297436	missense	probably damaging	1.00
X0065:Vmn2r15	UTSW	5	109293308	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGCTGCCCTACATTGTAAGTAC -3'
(R):5'- GCTTTCTTGGCTAGGAACCTTC -3'

Sequencing Primer
(F):5'- GCCCTACATTGTAAGTACTAACTTTG -3'
(R):5'- GGAACCTTCCTGACAGATTCAATG -3'

Posted On

2019-12-20