Incidental Mutation 'R7892:Vmn2r68'
ID 609384
Institutional Source Beutler Lab
Gene Symbol Vmn2r68
Ensembl Gene ENSMUSG00000096861
Gene Name vomeronasal 2, receptor 68
Synonyms EG620697, Vmn2r68-ps
MMRRC Submission 045944-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R7892 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 84870726-84886912 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84883722 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 128 (T128A)
Ref Sequence ENSEMBL: ENSMUSP00000129411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061074]
AlphaFold L7N2B3
Predicted Effect probably benign
Transcript: ENSMUST00000061074
AA Change: T128A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861
AA Change: T128A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 463 4.5e-28 PFAM
Pfam:NCD3G 507 559 1.1e-18 PFAM
Pfam:7tm_3 589 827 3.7e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A G 16: 14,436,349 (GRCm39) E134G Het
Acsm4 G A 7: 119,293,889 (GRCm39) V87M possibly damaging Het
Adamts3 T C 5: 90,009,288 (GRCm39) N125S probably benign Het
Arhgef4 A G 1: 34,760,885 (GRCm39) E47G unknown Het
C1ra A G 6: 124,496,374 (GRCm39) M367V probably benign Het
Ces2b T C 8: 105,559,385 (GRCm39) W84R probably damaging Het
Clca3a1 T C 3: 144,436,579 (GRCm39) T835A probably benign Het
Cmya5 T C 13: 93,232,865 (GRCm39) E741G probably damaging Het
Cspg4b C T 13: 113,456,140 (GRCm39) R729C Het
D330020A13Rik T C 6: 120,271,819 (GRCm39) L165P unknown Het
Dtnbp1 A T 13: 45,075,765 (GRCm39) L326* probably null Het
Ecpas T C 4: 58,828,593 (GRCm39) I947V probably benign Het
Fat4 A T 3: 39,003,588 (GRCm39) probably null Het
Fbxl9 A T 8: 106,042,165 (GRCm39) I221N possibly damaging Het
Fuom T A 7: 139,679,492 (GRCm39) I143F unknown Het
Gm14444 A T 2: 174,858,524 (GRCm39) M33L probably damaging Het
Hmcn1 T C 1: 150,540,643 (GRCm39) T2889A probably benign Het
Kif5b G A 18: 6,212,517 (GRCm39) T769M probably benign Het
Kif9 G A 9: 110,343,682 (GRCm39) R567H not run Het
Kmt2c A T 5: 25,504,814 (GRCm39) M3498K probably benign Het
Ly6e T A 15: 74,829,700 (GRCm39) L15* probably null Het
Malt1 G A 18: 65,597,187 (GRCm39) probably null Het
Msantd5 G A 11: 51,125,613 (GRCm39) E179K possibly damaging Het
Mylk G C 16: 34,699,894 (GRCm39) S419T probably benign Het
Oacyl T C 18: 65,870,918 (GRCm39) L373P probably benign Het
Or10d1 A C 9: 39,483,845 (GRCm39) S237A possibly damaging Het
Or4b1d T C 2: 89,968,836 (GRCm39) I216V probably benign Het
Or5b116 T A 19: 13,422,662 (GRCm39) C95* probably null Het
Or5b21 C T 19: 12,839,843 (GRCm39) R235* probably null Het
Pcdh20 A T 14: 88,704,867 (GRCm39) L811* probably null Het
Pgrmc2 A T 3: 41,037,415 (GRCm39) D5E probably damaging Het
Pign A C 1: 105,585,401 (GRCm39) F49L probably benign Het
Pip5k1b T C 19: 24,337,457 (GRCm39) D277G probably benign Het
Ppm1m A G 9: 106,075,895 (GRCm39) V11A probably benign Het
Prl7a1 A T 13: 27,817,661 (GRCm39) V201E not run Het
Samhd1 A G 2: 156,958,415 (GRCm39) S269P probably damaging Het
Sik2 A G 9: 50,920,132 (GRCm39) V15A probably damaging Het
Slc4a7 G A 14: 14,773,348 (GRCm38) E773K probably benign Het
Sntg1 T C 1: 8,853,024 (GRCm39) D42G probably damaging Het
Speg A T 1: 75,403,810 (GRCm39) N2664Y probably damaging Het
Tcstv1b G T 13: 120,634,695 (GRCm39) probably benign Het
Treh A G 9: 44,596,015 (GRCm39) Y435C probably damaging Het
Trim59 A G 3: 68,945,140 (GRCm39) S67P probably benign Het
Trim68 A T 7: 102,328,004 (GRCm39) C309S unknown Het
Tubb4a G T 17: 57,387,880 (GRCm39) S382* probably null Het
Vmn2r15 A T 5: 109,434,217 (GRCm39) I829N probably damaging Het
Vmn2r70 T A 7: 85,208,588 (GRCm39) I630L possibly damaging Het
Zc3hav1 A G 6: 38,306,156 (GRCm39) I632T probably benign Het
Zfp558 A G 9: 18,379,993 (GRCm39) S13P possibly damaging Het
Other mutations in Vmn2r68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Vmn2r68 APN 7 84,886,819 (GRCm39) missense probably benign
IGL01477:Vmn2r68 APN 7 84,882,691 (GRCm39) missense probably damaging 1.00
IGL01600:Vmn2r68 APN 7 84,871,468 (GRCm39) missense probably benign 0.39
IGL01979:Vmn2r68 APN 7 84,871,325 (GRCm39) missense probably benign
IGL01999:Vmn2r68 APN 7 84,871,439 (GRCm39) missense probably damaging 1.00
IGL02269:Vmn2r68 APN 7 84,870,947 (GRCm39) missense possibly damaging 0.84
IGL02517:Vmn2r68 APN 7 84,871,153 (GRCm39) nonsense probably null
IGL02827:Vmn2r68 APN 7 84,886,800 (GRCm39) missense probably damaging 1.00
IGL02852:Vmn2r68 APN 7 84,882,595 (GRCm39) missense probably damaging 1.00
IGL02982:Vmn2r68 APN 7 84,883,649 (GRCm39) missense probably benign 0.12
IGL03099:Vmn2r68 APN 7 84,871,448 (GRCm39) nonsense probably null
IGL03166:Vmn2r68 APN 7 84,871,331 (GRCm39) missense probably benign 0.01
IGL03168:Vmn2r68 APN 7 84,870,972 (GRCm39) missense probably damaging 1.00
IGL03243:Vmn2r68 APN 7 84,882,963 (GRCm39) missense possibly damaging 0.66
F5770:Vmn2r68 UTSW 7 84,871,088 (GRCm39) missense probably benign 0.01
R0280:Vmn2r68 UTSW 7 84,882,466 (GRCm39) critical splice donor site probably null
R0280:Vmn2r68 UTSW 7 84,882,457 (GRCm39) splice site probably benign
R0281:Vmn2r68 UTSW 7 84,882,466 (GRCm39) critical splice donor site probably null
R0281:Vmn2r68 UTSW 7 84,882,457 (GRCm39) splice site probably benign
R0348:Vmn2r68 UTSW 7 84,870,884 (GRCm39) missense possibly damaging 0.50
R0390:Vmn2r68 UTSW 7 84,882,466 (GRCm39) critical splice donor site probably null
R0390:Vmn2r68 UTSW 7 84,882,457 (GRCm39) splice site probably benign
R0722:Vmn2r68 UTSW 7 84,870,794 (GRCm39) missense possibly damaging 0.95
R1129:Vmn2r68 UTSW 7 84,886,712 (GRCm39) splice site probably null
R1136:Vmn2r68 UTSW 7 84,871,549 (GRCm39) missense possibly damaging 0.81
R1319:Vmn2r68 UTSW 7 84,881,700 (GRCm39) missense probably damaging 0.96
R1614:Vmn2r68 UTSW 7 84,870,946 (GRCm39) missense possibly damaging 0.93
R1682:Vmn2r68 UTSW 7 84,882,574 (GRCm39) missense possibly damaging 0.68
R1837:Vmn2r68 UTSW 7 84,882,886 (GRCm39) missense probably damaging 0.96
R1893:Vmn2r68 UTSW 7 84,883,867 (GRCm39) nonsense probably null
R1908:Vmn2r68 UTSW 7 84,883,260 (GRCm39) missense probably benign 0.09
R1909:Vmn2r68 UTSW 7 84,883,260 (GRCm39) missense probably benign 0.09
R1951:Vmn2r68 UTSW 7 84,883,102 (GRCm39) missense probably damaging 1.00
R2177:Vmn2r68 UTSW 7 84,871,123 (GRCm39) missense probably benign 0.01
R2178:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R2185:Vmn2r68 UTSW 7 84,882,901 (GRCm39) nonsense probably null
R2188:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R2282:Vmn2r68 UTSW 7 84,870,859 (GRCm39) missense possibly damaging 0.65
R2567:Vmn2r68 UTSW 7 84,883,803 (GRCm39) missense probably benign
R2869:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2869:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2873:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2874:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R3149:Vmn2r68 UTSW 7 84,886,875 (GRCm39) missense probably benign 0.00
R3401:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R3978:Vmn2r68 UTSW 7 84,881,670 (GRCm39) missense probably benign 0.00
R4399:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4401:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4421:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4478:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4479:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4495:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4628:Vmn2r68 UTSW 7 84,883,673 (GRCm39) missense probably benign 0.00
R4649:Vmn2r68 UTSW 7 84,870,743 (GRCm39) missense probably benign
R4654:Vmn2r68 UTSW 7 84,882,769 (GRCm39) nonsense probably null
R4793:Vmn2r68 UTSW 7 84,883,648 (GRCm39) missense probably benign 0.01
R5007:Vmn2r68 UTSW 7 84,881,622 (GRCm39) missense probably benign
R5021:Vmn2r68 UTSW 7 84,882,942 (GRCm39) missense possibly damaging 0.62
R5082:Vmn2r68 UTSW 7 84,883,076 (GRCm39) missense probably benign 0.12
R5177:Vmn2r68 UTSW 7 84,871,199 (GRCm39) missense probably damaging 0.99
R5221:Vmn2r68 UTSW 7 84,871,085 (GRCm39) missense probably damaging 1.00
R5514:Vmn2r68 UTSW 7 84,886,767 (GRCm39) missense possibly damaging 0.92
R5521:Vmn2r68 UTSW 7 84,882,926 (GRCm39) missense probably benign 0.03
R5563:Vmn2r68 UTSW 7 84,871,283 (GRCm39) missense probably damaging 1.00
R5664:Vmn2r68 UTSW 7 84,882,978 (GRCm39) missense probably benign 0.02
R5829:Vmn2r68 UTSW 7 84,886,812 (GRCm39) missense probably benign 0.00
R6016:Vmn2r68 UTSW 7 84,871,453 (GRCm39) missense probably damaging 0.99
R6356:Vmn2r68 UTSW 7 84,883,048 (GRCm39) missense possibly damaging 0.85
R6413:Vmn2r68 UTSW 7 84,870,973 (GRCm39) missense probably damaging 1.00
R6418:Vmn2r68 UTSW 7 84,882,915 (GRCm39) missense probably benign
R6699:Vmn2r68 UTSW 7 84,881,583 (GRCm39) missense possibly damaging 0.58
R7287:Vmn2r68 UTSW 7 84,871,460 (GRCm39) missense probably benign 0.33
R7319:Vmn2r68 UTSW 7 84,883,042 (GRCm39) missense probably benign
R7374:Vmn2r68 UTSW 7 84,881,607 (GRCm39) missense possibly damaging 0.66
R7585:Vmn2r68 UTSW 7 84,881,587 (GRCm39) missense probably damaging 1.00
R7605:Vmn2r68 UTSW 7 84,883,116 (GRCm39) missense probably benign 0.01
R7979:Vmn2r68 UTSW 7 84,883,625 (GRCm39) critical splice donor site probably null
R8177:Vmn2r68 UTSW 7 84,871,422 (GRCm39) nonsense probably null
R8349:Vmn2r68 UTSW 7 84,882,785 (GRCm39) missense probably damaging 1.00
R8378:Vmn2r68 UTSW 7 84,871,108 (GRCm39) missense probably benign 0.00
R8397:Vmn2r68 UTSW 7 84,886,722 (GRCm39) missense possibly damaging 0.71
R8449:Vmn2r68 UTSW 7 84,882,785 (GRCm39) missense probably damaging 1.00
R8543:Vmn2r68 UTSW 7 84,883,648 (GRCm39) missense probably benign 0.01
R8680:Vmn2r68 UTSW 7 84,871,321 (GRCm39) missense possibly damaging 0.68
R9056:Vmn2r68 UTSW 7 84,871,420 (GRCm39) missense possibly damaging 0.71
R9342:Vmn2r68 UTSW 7 84,882,993 (GRCm39) missense probably benign 0.39
R9734:Vmn2r68 UTSW 7 84,882,757 (GRCm39) missense possibly damaging 0.54
V7581:Vmn2r68 UTSW 7 84,871,088 (GRCm39) missense probably benign 0.01
Z1176:Vmn2r68 UTSW 7 84,871,289 (GRCm39) missense probably benign 0.27
Z1176:Vmn2r68 UTSW 7 84,870,941 (GRCm39) missense probably damaging 1.00
Z1176:Vmn2r68 UTSW 7 84,871,307 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AATGCTGCTGCCTCCCATAC -3'
(R):5'- CCCAAGACCAACCATTTGATTTTC -3'

Sequencing Primer
(F):5'- GCCTCCCATACCCATTTATGATAAAG -3'
(R):5'- CTCTGTTTATCTTGCCTTGGATG -3'
Posted On 2019-12-20