Incidental Mutation 'R7892:Trim68'
ID609386
Institutional Source Beutler Lab
Gene Symbol Trim68
Ensembl Gene ENSMUSG00000073968
Gene Nametripartite motif-containing 68
SynonymsRnf137, F730114J12Rik, SS-56
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7892 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location102677582-102687327 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102678797 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 309 (C309S)
Ref Sequence ENSEMBL: ENSMUSP00000147991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082175] [ENSMUST00000210855]
Predicted Effect silent
Transcript: ENSMUST00000082175
SMART Domains Protein: ENSMUSP00000080813
Gene: ENSMUSG00000073968

DomainStartEndE-ValueType
RING 16 60 1.61e-8 SMART
BBOX 93 134 9.89e-9 SMART
coiled coil region 187 226 N/A INTRINSIC
PRY 302 354 1.91e-24 SMART
SPRY 355 482 3.03e-28 SMART
Predicted Effect unknown
Transcript: ENSMUST00000210855
AA Change: C309S
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif-containing protein family, whose members are characterized by a "really interesting new gene" (RING) finger domain, a zinc-binding B-box motif, and a coiled-coil region. Members of this family function as E3 ubiquitin ligases and are involved in a broad range of biological processes. This gene regulates the activation of nuclear receptors, such as androgen receptor, and has been implicated in development of prostate cancer cells, where its expression increases in response to a downregulation of microRNAs. In addition, this gene participates in viral defense regulation as a negative regulator of interferon-beta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A G 16: 14,618,485 E134G Het
Acsm4 G A 7: 119,694,666 V87M possibly damaging Het
Adamts3 T C 5: 89,861,429 N125S probably benign Het
AI314180 T C 4: 58,828,593 I947V probably benign Het
Arhgef4 A G 1: 34,721,804 E47G unknown Het
BC067074 C T 13: 113,319,606 R729C Het
C1ra A G 6: 124,519,415 M367V probably benign Het
Ces2b T C 8: 104,832,753 W84R probably damaging Het
Clca3a1 T C 3: 144,730,818 T835A probably benign Het
Cmya5 T C 13: 93,096,357 E741G probably damaging Het
D330020A13Rik T C 6: 120,294,858 L165P unknown Het
Dtnbp1 A T 13: 44,922,289 L326* probably null Het
Fat4 A T 3: 38,949,439 probably null Het
Fuom T A 7: 140,099,579 I143F unknown Het
Gm12569 G A 11: 51,234,786 E179K possibly damaging Het
Gm14444 A T 2: 175,016,731 M33L probably damaging Het
Gm21818 G T 13: 120,173,159 probably benign Het
Hmcn1 T C 1: 150,664,892 T2889A probably benign Het
Kif5b G A 18: 6,212,517 T769M probably benign Het
Kif9 G A 9: 110,514,614 R567H not run Het
Kmt2c A T 5: 25,299,816 M3498K probably benign Het
Lrrc29 A T 8: 105,315,533 I221N possibly damaging Het
Ly6e T A 15: 74,957,851 L15* probably null Het
Malt1 G A 18: 65,464,116 probably null Het
Mylk G C 16: 34,879,524 S419T probably benign Het
Oacyl T C 18: 65,737,847 L373P probably benign Het
Olfr1444 C T 19: 12,862,479 R235* probably null Het
Olfr1471 T A 19: 13,445,298 C95* probably null Het
Olfr32 T C 2: 90,138,492 I216V probably benign Het
Olfr959 A C 9: 39,572,549 S237A possibly damaging Het
Pcdh20 A T 14: 88,467,431 L811* probably null Het
Pgrmc2 A T 3: 41,082,980 D5E probably damaging Het
Pign A C 1: 105,657,676 F49L probably benign Het
Pip5k1b T C 19: 24,360,093 D277G probably benign Het
Ppm1m A G 9: 106,198,696 V11A probably benign Het
Prl7a1 A T 13: 27,633,678 V201E not run Het
Samhd1 A G 2: 157,116,495 S269P probably damaging Het
Sik2 A G 9: 51,008,832 V15A probably damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Sntg1 T C 1: 8,782,800 D42G probably damaging Het
Speg A T 1: 75,427,166 N2664Y probably damaging Het
Treh A G 9: 44,684,718 Y435C probably damaging Het
Trim59 A G 3: 69,037,807 S67P probably benign Het
Tubb4a G T 17: 57,080,880 S382* probably null Het
Vmn2r15 A T 5: 109,286,351 I829N probably damaging Het
Vmn2r68 T C 7: 85,234,514 T128A probably benign Het
Vmn2r70 T A 7: 85,559,380 I630L possibly damaging Het
Zc3hav1 A G 6: 38,329,221 I632T probably benign Het
Zfp558 A G 9: 18,468,697 S13P possibly damaging Het
Other mutations in Trim68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Trim68 APN 7 102679141 splice site probably null
IGL02703:Trim68 APN 7 102684079 missense probably damaging 0.99
IGL02835:Trim68 UTSW 7 102678573 missense probably benign 0.21
R1765:Trim68 UTSW 7 102680390 missense possibly damaging 0.82
R1780:Trim68 UTSW 7 102684073 missense possibly damaging 0.58
R4107:Trim68 UTSW 7 102678451 missense probably benign 0.01
R4451:Trim68 UTSW 7 102684473 start codon destroyed probably damaging 1.00
R5385:Trim68 UTSW 7 102678783 missense probably damaging 1.00
R5793:Trim68 UTSW 7 102684353 missense possibly damaging 0.74
R5980:Trim68 UTSW 7 102678831 missense probably damaging 1.00
R6749:Trim68 UTSW 7 102678783 missense probably damaging 0.99
R6912:Trim68 UTSW 7 102684468 missense probably damaging 1.00
R7396:Trim68 UTSW 7 102678362 nonsense probably null
R7789:Trim68 UTSW 7 102684469 missense possibly damaging 0.61
R8096:Trim68 UTSW 7 102678442 missense probably damaging 1.00
X0067:Trim68 UTSW 7 102684132 missense probably benign 0.00
Z1176:Trim68 UTSW 7 102678813 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGGATAAGTACACCACCTCC -3'
(R):5'- AATGGCTCAGTGCAATCTGG -3'

Sequencing Primer
(F):5'- GATAAGTACACCACCTCCTTCCGG -3'
(R):5'- CAGTGCAATCTGGATGCTTCATCTAG -3'
Posted On2019-12-20