Incidental Mutation 'R7892:Sik2'
ID609394
Institutional Source Beutler Lab
Gene Symbol Sik2
Ensembl Gene ENSMUSG00000037112
Gene Namesalt inducible kinase 2
SynonymsSnf1lk2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.653) question?
Stock #R7892 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location50892801-51009073 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51008832 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 15 (V15A)
Ref Sequence ENSEMBL: ENSMUSP00000038761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041375] [ENSMUST00000176491] [ENSMUST00000176663] [ENSMUST00000176824]
Predicted Effect probably damaging
Transcript: ENSMUST00000041375
AA Change: V15A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038761
Gene: ENSMUSG00000037112
AA Change: V15A

DomainStartEndE-ValueType
S_TKc 20 271 4.63e-101 SMART
low complexity region 454 464 N/A INTRINSIC
low complexity region 643 664 N/A INTRINSIC
low complexity region 708 731 N/A INTRINSIC
low complexity region 800 842 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176491
AA Change: V15A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134954
Gene: ENSMUSG00000037112
AA Change: V15A

DomainStartEndE-ValueType
S_TKc 20 271 4.63e-101 SMART
low complexity region 454 464 N/A INTRINSIC
low complexity region 643 664 N/A INTRINSIC
low complexity region 708 731 N/A INTRINSIC
low complexity region 800 842 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176663
AA Change: V15A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135376
Gene: ENSMUSG00000037112
AA Change: V15A

DomainStartEndE-ValueType
S_TKc 20 271 4.63e-101 SMART
low complexity region 454 464 N/A INTRINSIC
low complexity region 643 664 N/A INTRINSIC
low complexity region 708 731 N/A INTRINSIC
low complexity region 800 842 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176824
AA Change: V15A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134936
Gene: ENSMUSG00000037112
AA Change: V15A

DomainStartEndE-ValueType
S_TKc 20 271 4.63e-101 SMART
low complexity region 454 464 N/A INTRINSIC
low complexity region 643 664 N/A INTRINSIC
low complexity region 708 731 N/A INTRINSIC
low complexity region 800 842 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice heterozygous for a knock-out allele exhibit darkened hair color in an agouti background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A G 16: 14,618,485 E134G Het
Acsm4 G A 7: 119,694,666 V87M possibly damaging Het
Adamts3 T C 5: 89,861,429 N125S probably benign Het
AI314180 T C 4: 58,828,593 I947V probably benign Het
Arhgef4 A G 1: 34,721,804 E47G unknown Het
BC067074 C T 13: 113,319,606 R729C Het
C1ra A G 6: 124,519,415 M367V probably benign Het
Ces2b T C 8: 104,832,753 W84R probably damaging Het
Clca3a1 T C 3: 144,730,818 T835A probably benign Het
Cmya5 T C 13: 93,096,357 E741G probably damaging Het
D330020A13Rik T C 6: 120,294,858 L165P unknown Het
Dtnbp1 A T 13: 44,922,289 L326* probably null Het
Fat4 A T 3: 38,949,439 probably null Het
Fuom T A 7: 140,099,579 I143F unknown Het
Gm12569 G A 11: 51,234,786 E179K possibly damaging Het
Gm14444 A T 2: 175,016,731 M33L probably damaging Het
Gm21818 G T 13: 120,173,159 probably benign Het
Hmcn1 T C 1: 150,664,892 T2889A probably benign Het
Kif5b G A 18: 6,212,517 T769M probably benign Het
Kif9 G A 9: 110,514,614 R567H not run Het
Kmt2c A T 5: 25,299,816 M3498K probably benign Het
Lrrc29 A T 8: 105,315,533 I221N possibly damaging Het
Ly6e T A 15: 74,957,851 L15* probably null Het
Malt1 G A 18: 65,464,116 probably null Het
Mylk G C 16: 34,879,524 S419T probably benign Het
Oacyl T C 18: 65,737,847 L373P probably benign Het
Olfr1444 C T 19: 12,862,479 R235* probably null Het
Olfr1471 T A 19: 13,445,298 C95* probably null Het
Olfr32 T C 2: 90,138,492 I216V probably benign Het
Olfr959 A C 9: 39,572,549 S237A possibly damaging Het
Pcdh20 A T 14: 88,467,431 L811* probably null Het
Pgrmc2 A T 3: 41,082,980 D5E probably damaging Het
Pign A C 1: 105,657,676 F49L probably benign Het
Pip5k1b T C 19: 24,360,093 D277G probably benign Het
Ppm1m A G 9: 106,198,696 V11A probably benign Het
Prl7a1 A T 13: 27,633,678 V201E not run Het
Samhd1 A G 2: 157,116,495 S269P probably damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Sntg1 T C 1: 8,782,800 D42G probably damaging Het
Speg A T 1: 75,427,166 N2664Y probably damaging Het
Treh A G 9: 44,684,718 Y435C probably damaging Het
Trim59 A G 3: 69,037,807 S67P probably benign Het
Trim68 A T 7: 102,678,797 C309S unknown Het
Tubb4a G T 17: 57,080,880 S382* probably null Het
Vmn2r15 A T 5: 109,286,351 I829N probably damaging Het
Vmn2r68 T C 7: 85,234,514 T128A probably benign Het
Vmn2r70 T A 7: 85,559,380 I630L possibly damaging Het
Zc3hav1 A G 6: 38,329,221 I632T probably benign Het
Zfp558 A G 9: 18,468,697 S13P possibly damaging Het
Other mutations in Sik2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Sik2 APN 9 50907463 missense probably damaging 0.96
IGL01552:Sik2 APN 9 50917522 splice site probably benign
IGL02175:Sik2 APN 9 50895609 nonsense probably null
IGL02355:Sik2 APN 9 50917603 nonsense probably null
IGL02362:Sik2 APN 9 50917603 nonsense probably null
IGL03197:Sik2 APN 9 50895773 missense probably damaging 1.00
R0066:Sik2 UTSW 9 50998533 missense probably benign 0.18
R0066:Sik2 UTSW 9 50998533 missense probably benign 0.18
R0109:Sik2 UTSW 9 50899475 missense possibly damaging 0.50
R0109:Sik2 UTSW 9 50899475 missense possibly damaging 0.50
R0416:Sik2 UTSW 9 50995632 missense probably damaging 1.00
R0648:Sik2 UTSW 9 50898745 missense probably benign 0.26
R0714:Sik2 UTSW 9 50907436 missense probably benign 0.13
R1472:Sik2 UTSW 9 51008811 missense probably damaging 1.00
R1592:Sik2 UTSW 9 50995671 missense probably damaging 1.00
R1899:Sik2 UTSW 9 50995674 splice site probably benign
R2032:Sik2 UTSW 9 50995647 missense probably damaging 1.00
R2079:Sik2 UTSW 9 50907406 critical splice donor site probably null
R2853:Sik2 UTSW 9 50898297 missense probably damaging 1.00
R4085:Sik2 UTSW 9 50935385 intron probably benign
R4567:Sik2 UTSW 9 50998576 missense probably damaging 1.00
R5098:Sik2 UTSW 9 50995591 intron probably benign
R5176:Sik2 UTSW 9 50899403 missense probably benign 0.02
R5640:Sik2 UTSW 9 50915506 missense possibly damaging 0.93
R5682:Sik2 UTSW 9 50917082 missense probably damaging 1.00
R5779:Sik2 UTSW 9 50895845 missense probably benign
R5935:Sik2 UTSW 9 50917131 missense probably damaging 1.00
R5997:Sik2 UTSW 9 50895342 critical splice donor site probably null
R6664:Sik2 UTSW 9 50935457 missense probably damaging 1.00
R6787:Sik2 UTSW 9 50998534 missense possibly damaging 0.67
R6980:Sik2 UTSW 9 50897455 missense probably benign 0.00
R7057:Sik2 UTSW 9 50998561 missense probably damaging 1.00
R7064:Sik2 UTSW 9 50907420 missense probably damaging 0.99
R7165:Sik2 UTSW 9 50917097 missense probably damaging 1.00
R8252:Sik2 UTSW 9 50917115 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AAGACGCGGAACTTGTGCTC -3'
(R):5'- TCTTGCGCTTCTGCTGGAA -3'

Sequencing Primer
(F):5'- CGGAACTTGTGCTCAGGAG -3'
(R):5'- TGCGGTAGCCATGGTGAC -3'
Posted On2019-12-20