Incidental Mutation 'R7892:Olfr1444'
ID609412
Institutional Source Beutler Lab
Gene Symbol Olfr1444
Ensembl Gene ENSMUSG00000046272
Gene Nameolfactory receptor 1444
SynonymsMOR202-4, GA_x6K02T2RE5P-3191201-3192160
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R7892 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location12857283-12863440 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 12862479 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 235 (R235*)
Ref Sequence ENSEMBL: ENSMUSP00000150212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059675] [ENSMUST00000213606]
Predicted Effect probably null
Transcript: ENSMUST00000059675
AA Change: R235*
SMART Domains Protein: ENSMUSP00000062460
Gene: ENSMUSG00000046272
AA Change: R235*

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 1.6e-54 PFAM
Pfam:7tm_1 42 291 5.3e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213606
AA Change: R235*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A G 16: 14,618,485 E134G Het
Acsm4 G A 7: 119,694,666 V87M possibly damaging Het
Adamts3 T C 5: 89,861,429 N125S probably benign Het
AI314180 T C 4: 58,828,593 I947V probably benign Het
Arhgef4 A G 1: 34,721,804 E47G unknown Het
BC067074 C T 13: 113,319,606 R729C Het
C1ra A G 6: 124,519,415 M367V probably benign Het
Ces2b T C 8: 104,832,753 W84R probably damaging Het
Clca3a1 T C 3: 144,730,818 T835A probably benign Het
Cmya5 T C 13: 93,096,357 E741G probably damaging Het
D330020A13Rik T C 6: 120,294,858 L165P unknown Het
Dtnbp1 A T 13: 44,922,289 L326* probably null Het
Fat4 A T 3: 38,949,439 probably null Het
Fuom T A 7: 140,099,579 I143F unknown Het
Gm12569 G A 11: 51,234,786 E179K possibly damaging Het
Gm14444 A T 2: 175,016,731 M33L probably damaging Het
Gm21818 G T 13: 120,173,159 probably benign Het
Hmcn1 T C 1: 150,664,892 T2889A probably benign Het
Kif5b G A 18: 6,212,517 T769M probably benign Het
Kif9 G A 9: 110,514,614 R567H not run Het
Kmt2c A T 5: 25,299,816 M3498K probably benign Het
Lrrc29 A T 8: 105,315,533 I221N possibly damaging Het
Ly6e T A 15: 74,957,851 L15* probably null Het
Malt1 G A 18: 65,464,116 probably null Het
Mylk G C 16: 34,879,524 S419T probably benign Het
Oacyl T C 18: 65,737,847 L373P probably benign Het
Olfr1471 T A 19: 13,445,298 C95* probably null Het
Olfr32 T C 2: 90,138,492 I216V probably benign Het
Olfr959 A C 9: 39,572,549 S237A possibly damaging Het
Pcdh20 A T 14: 88,467,431 L811* probably null Het
Pgrmc2 A T 3: 41,082,980 D5E probably damaging Het
Pign A C 1: 105,657,676 F49L probably benign Het
Pip5k1b T C 19: 24,360,093 D277G probably benign Het
Ppm1m A G 9: 106,198,696 V11A probably benign Het
Prl7a1 A T 13: 27,633,678 V201E not run Het
Samhd1 A G 2: 157,116,495 S269P probably damaging Het
Sik2 A G 9: 51,008,832 V15A probably damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Sntg1 T C 1: 8,782,800 D42G probably damaging Het
Speg A T 1: 75,427,166 N2664Y probably damaging Het
Treh A G 9: 44,684,718 Y435C probably damaging Het
Trim59 A G 3: 69,037,807 S67P probably benign Het
Trim68 A T 7: 102,678,797 C309S unknown Het
Tubb4a G T 17: 57,080,880 S382* probably null Het
Vmn2r15 A T 5: 109,286,351 I829N probably damaging Het
Vmn2r68 T C 7: 85,234,514 T128A probably benign Het
Vmn2r70 T A 7: 85,559,380 I630L possibly damaging Het
Zc3hav1 A G 6: 38,329,221 I632T probably benign Het
Zfp558 A G 9: 18,468,697 S13P possibly damaging Het
Other mutations in Olfr1444
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01668:Olfr1444 APN 19 12861867 missense probably benign 0.00
IGL01963:Olfr1444 APN 19 12862382 missense probably benign 0.00
IGL02030:Olfr1444 APN 19 12862435 missense probably benign 0.00
IGL02178:Olfr1444 APN 19 12862543 missense possibly damaging 0.49
IGL02641:Olfr1444 APN 19 12862202 nonsense probably null
R0311:Olfr1444 UTSW 19 12861869 missense probably benign 0.01
R0543:Olfr1444 UTSW 19 12861888 missense probably benign 0.00
R0815:Olfr1444 UTSW 19 12862644 missense probably benign 0.00
R2034:Olfr1444 UTSW 19 12861787 missense possibly damaging 0.82
R2078:Olfr1444 UTSW 19 12862387 missense probably benign 0.05
R2431:Olfr1444 UTSW 19 12862606 missense probably damaging 1.00
R3032:Olfr1444 UTSW 19 12861918 missense probably benign 0.00
R3932:Olfr1444 UTSW 19 12862630 missense possibly damaging 0.95
R4498:Olfr1444 UTSW 19 12862669 missense probably damaging 1.00
R4654:Olfr1444 UTSW 19 12862232 nonsense probably null
R4708:Olfr1444 UTSW 19 12861897 missense probably benign 0.00
R4823:Olfr1444 UTSW 19 12861816 missense probably benign 0.04
R4938:Olfr1444 UTSW 19 12862552 missense probably damaging 1.00
R4980:Olfr1444 UTSW 19 12862020 missense probably benign
R5580:Olfr1444 UTSW 19 12861804 missense possibly damaging 0.59
R5622:Olfr1444 UTSW 19 12862299 missense probably benign 0.08
R5671:Olfr1444 UTSW 19 12861807 missense probably benign 0.02
R6149:Olfr1444 UTSW 19 12862359 missense probably benign 0.02
R6683:Olfr1444 UTSW 19 12862650 missense probably damaging 0.98
R7389:Olfr1444 UTSW 19 12862617 missense probably benign 0.04
R7392:Olfr1444 UTSW 19 12862587 missense probably benign 0.18
R7461:Olfr1444 UTSW 19 12861777 start codon destroyed probably benign 0.00
R7613:Olfr1444 UTSW 19 12861777 start codon destroyed probably benign 0.00
R7698:Olfr1444 UTSW 19 12862713 missense possibly damaging 0.69
R7717:Olfr1444 UTSW 19 12861795 missense probably benign 0.07
Z1088:Olfr1444 UTSW 19 12862284 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCTCAATCCATGCTGC -3'
(R):5'- ATCAAGGGGTTCAACATGGG -3'

Sequencing Primer
(F):5'- TCCATGCTGCAGATACCTTTAAAC -3'
(R):5'- GGTTCAACATGGGAATCACTAC -3'
Posted On2019-12-20