Incidental Mutation 'R7892:Pip5k1b'
ID609414
Institutional Source Beutler Lab
Gene Symbol Pip5k1b
Ensembl Gene ENSMUSG00000024867
Gene Namephosphatidylinositol-4-phosphate 5-kinase, type 1 beta
SynonymsPipk5b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R7892 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location24294794-24555872 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24360093 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 277 (D277G)
Ref Sequence ENSEMBL: ENSMUSP00000025800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025800] [ENSMUST00000112673]
Predicted Effect probably benign
Transcript: ENSMUST00000025800
AA Change: D277G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000025800
Gene: ENSMUSG00000024867
AA Change: D277G

DomainStartEndE-ValueType
PIPKc 53 396 1.1e-159 SMART
low complexity region 472 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112673
AA Change: D277G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000108292
Gene: ENSMUSG00000024867
AA Change: D277G

DomainStartEndE-ValueType
PIPKc 53 396 1.1e-159 SMART
low complexity region 420 432 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced passive cutaneous and systemic anaphylaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A G 16: 14,618,485 E134G Het
Acsm4 G A 7: 119,694,666 V87M possibly damaging Het
Adamts3 T C 5: 89,861,429 N125S probably benign Het
AI314180 T C 4: 58,828,593 I947V probably benign Het
Arhgef4 A G 1: 34,721,804 E47G unknown Het
BC067074 C T 13: 113,319,606 R729C Het
C1ra A G 6: 124,519,415 M367V probably benign Het
Ces2b T C 8: 104,832,753 W84R probably damaging Het
Clca3a1 T C 3: 144,730,818 T835A probably benign Het
Cmya5 T C 13: 93,096,357 E741G probably damaging Het
D330020A13Rik T C 6: 120,294,858 L165P unknown Het
Dtnbp1 A T 13: 44,922,289 L326* probably null Het
Fat4 A T 3: 38,949,439 probably null Het
Fuom T A 7: 140,099,579 I143F unknown Het
Gm12569 G A 11: 51,234,786 E179K possibly damaging Het
Gm14444 A T 2: 175,016,731 M33L probably damaging Het
Gm21818 G T 13: 120,173,159 probably benign Het
Hmcn1 T C 1: 150,664,892 T2889A probably benign Het
Kif5b G A 18: 6,212,517 T769M probably benign Het
Kif9 G A 9: 110,514,614 R567H not run Het
Kmt2c A T 5: 25,299,816 M3498K probably benign Het
Lrrc29 A T 8: 105,315,533 I221N possibly damaging Het
Ly6e T A 15: 74,957,851 L15* probably null Het
Malt1 G A 18: 65,464,116 probably null Het
Mylk G C 16: 34,879,524 S419T probably benign Het
Oacyl T C 18: 65,737,847 L373P probably benign Het
Olfr1444 C T 19: 12,862,479 R235* probably null Het
Olfr1471 T A 19: 13,445,298 C95* probably null Het
Olfr32 T C 2: 90,138,492 I216V probably benign Het
Olfr959 A C 9: 39,572,549 S237A possibly damaging Het
Pcdh20 A T 14: 88,467,431 L811* probably null Het
Pgrmc2 A T 3: 41,082,980 D5E probably damaging Het
Pign A C 1: 105,657,676 F49L probably benign Het
Ppm1m A G 9: 106,198,696 V11A probably benign Het
Prl7a1 A T 13: 27,633,678 V201E not run Het
Samhd1 A G 2: 157,116,495 S269P probably damaging Het
Sik2 A G 9: 51,008,832 V15A probably damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Sntg1 T C 1: 8,782,800 D42G probably damaging Het
Speg A T 1: 75,427,166 N2664Y probably damaging Het
Treh A G 9: 44,684,718 Y435C probably damaging Het
Trim59 A G 3: 69,037,807 S67P probably benign Het
Trim68 A T 7: 102,678,797 C309S unknown Het
Tubb4a G T 17: 57,080,880 S382* probably null Het
Vmn2r15 A T 5: 109,286,351 I829N probably damaging Het
Vmn2r68 T C 7: 85,234,514 T128A probably benign Het
Vmn2r70 T A 7: 85,559,380 I630L possibly damaging Het
Zc3hav1 A G 6: 38,329,221 I632T probably benign Het
Zfp558 A G 9: 18,468,697 S13P possibly damaging Het
Other mutations in Pip5k1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02642:Pip5k1b APN 19 24346367 missense probably benign 0.00
R0109:Pip5k1b UTSW 19 24379047 missense probably benign
R0109:Pip5k1b UTSW 19 24379047 missense probably benign
R0726:Pip5k1b UTSW 19 24378892 missense probably damaging 0.99
R1737:Pip5k1b UTSW 19 24397040 missense probably damaging 1.00
R2211:Pip5k1b UTSW 19 24378850 missense probably damaging 1.00
R2280:Pip5k1b UTSW 19 24378947 missense probably damaging 1.00
R2281:Pip5k1b UTSW 19 24378947 missense probably damaging 1.00
R4703:Pip5k1b UTSW 19 24355153 missense probably damaging 1.00
R4953:Pip5k1b UTSW 19 24390435 missense probably damaging 1.00
R5341:Pip5k1b UTSW 19 24304076 missense probably benign 0.00
R5493:Pip5k1b UTSW 19 24439075 missense probably benign
R5514:Pip5k1b UTSW 19 24350141 missense probably damaging 0.99
R5908:Pip5k1b UTSW 19 24397137 missense possibly damaging 0.95
R6083:Pip5k1b UTSW 19 24304035 nonsense probably null
R6219:Pip5k1b UTSW 19 24381823 missense probably damaging 1.00
R7009:Pip5k1b UTSW 19 24359935 splice site probably null
R7097:Pip5k1b UTSW 19 24358060 missense probably damaging 1.00
R7167:Pip5k1b UTSW 19 24397069 missense probably benign
R7682:Pip5k1b UTSW 19 24359979 missense probably damaging 1.00
R8121:Pip5k1b UTSW 19 24359991 missense probably damaging 1.00
R8314:Pip5k1b UTSW 19 24355199 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CCAGAGTGCCATAAGGTGATTGG -3'
(R):5'- CTATGTGCCTCTCAGTGGAC -3'

Sequencing Primer
(F):5'- ATTAACTACTGAGTGACTGGGGTACC -3'
(R):5'- CCTCTCAGTGGACAGGGTGTG -3'
Posted On2019-12-20