Incidental Mutation 'R7893:Copa'
ID609415
Institutional Source Beutler Lab
Gene Symbol Copa
Ensembl Gene ENSMUSG00000026553
Gene Namecoatomer protein complex subunit alpha
Synonymsxenin
Accession Numbers

Genbank: NM_009938; MGI: 1334462

Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R7893 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location172082529-172122330 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 172119565 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 1085 (C1085*)
Ref Sequence ENSEMBL: ENSMUSP00000118179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027833] [ENSMUST00000135192]
Predicted Effect probably null
Transcript: ENSMUST00000027833
AA Change: C1094*
SMART Domains Protein: ENSMUSP00000027833
Gene: ENSMUSG00000026553
AA Change: C1094*

DomainStartEndE-ValueType
WD40 2 37 2.86e0 SMART
WD40 40 79 1.11e-6 SMART
WD40 82 121 4.76e-6 SMART
WD40 124 163 2.24e-11 SMART
WD40 194 233 2.98e-7 SMART
WD40 238 277 8.42e-7 SMART
WD40 280 318 1.38e1 SMART
Pfam:Coatomer_WDAD 338 776 5.4e-144 PFAM
Pfam:COPI_C 824 1233 1.4e-190 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000135192
AA Change: C1085*
SMART Domains Protein: ENSMUSP00000118179
Gene: ENSMUSG00000026553
AA Change: C1085*

DomainStartEndE-ValueType
WD40 2 37 2.86e0 SMART
WD40 40 79 1.11e-6 SMART
WD40 82 121 4.76e-6 SMART
WD40 124 163 2.24e-11 SMART
WD40 194 233 2.98e-7 SMART
WD40 238 277 8.42e-7 SMART
WD40 280 318 1.38e1 SMART
Pfam:Coatomer_WDAD 338 767 1.1e-148 PFAM
Pfam:COPI_C 815 1224 3.6e-216 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In eukaryotic cells, protein transport between the endoplasmic reticulum and Golgi compartments is mediated in part by non-clathrin-coated vesicular coat proteins (COPs). Seven coat proteins have been identified, and they represent subunits of a complex known as coatomer. The subunits are designated alpha-COP, beta-COP, beta-prime-COP, gamma-COP, delta-COP, epsilon-COP, and zeta-COP. The alpha-COP, encoded by COPA, shares high sequence similarity with RET1P, the alpha subunit of the coatomer complex in yeast. Also, the N-terminal 25 amino acids of alpha-COP encode the bioactive peptide, xenin, which stimulates exocrine pancreatic secretion and may act as a gastrointestinal hormone. Alternative splicing results in multiple splice forms encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(6) : Gene trapped(6)

 

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,971,539 W291R probably damaging Het
9130019O22Rik T A 7: 127,386,544 probably benign Het
Abca3 A T 17: 24,385,466 I604F probably damaging Het
Adar T A 3: 89,750,651 D1062E probably damaging Het
Agap2 A G 10: 127,080,195 T192A unknown Het
Aim2 T C 1: 173,463,926 V299A possibly damaging Het
Arhgap33 T C 7: 30,528,776 I394V probably benign Het
Atg2a T C 19: 6,251,296 F800S probably damaging Het
Btnl10 T A 11: 58,923,809 N438K probably benign Het
C9 T A 15: 6,483,245 F283I possibly damaging Het
Camk2n2 T C 16: 20,621,076 N40S possibly damaging Het
Cd53 T A 3: 106,767,386 I122F probably benign Het
Cpt1b A G 15: 89,423,654 probably null Het
Cyp24a1 C G 2: 170,496,516 probably null Het
Cyp2c40 A T 19: 39,786,848 V320E probably damaging Het
Efcab7 A T 4: 99,888,861 D210V probably damaging Het
Elfn2 G A 15: 78,673,168 T393I probably damaging Het
Fbxw11 A T 11: 32,720,489 I152L probably benign Het
Gab1 A T 8: 80,784,766 F483L possibly damaging Het
Git2 G T 5: 114,769,676 R43S possibly damaging Het
Gm11639 A C 11: 104,979,360 S3985R unknown Het
Gm43302 G A 5: 105,289,025 Q72* probably null Het
Hcn2 T C 10: 79,724,411 L192P probably damaging Het
Htra4 A C 8: 25,033,679 F290C possibly damaging Het
Ide C T 19: 37,284,151 V731I Het
Igsf9 T C 1: 172,497,302 L929P probably damaging Het
Iqgap2 G A 13: 95,689,709 A535V probably damaging Het
Itga10 T C 3: 96,649,612 W217R probably damaging Het
Kdm2b A G 5: 122,947,739 F276L probably benign Het
Klf16 T C 10: 80,576,960 S81G probably benign Het
L1td1 G T 4: 98,733,741 C180F possibly damaging Het
Map4k2 A C 19: 6,353,511 H817P probably damaging Het
Marf1 A T 16: 14,146,735 V446D probably damaging Het
Mfsd4b1 A G 10: 40,007,317 S46P probably benign Het
Mylk G C 16: 34,879,524 S419T probably benign Het
Nckipsd A G 9: 108,815,389 H604R probably damaging Het
Nedd9 A T 13: 41,315,789 D629E probably damaging Het
Nlrp5 C T 7: 23,418,165 T438I probably benign Het
Olfr1238 T A 2: 89,407,070 Q3L probably benign Het
Olfr507 A G 7: 108,622,637 K275R probably damaging Het
Olfr610 A T 7: 103,506,610 I112N possibly damaging Het
Otud7a G T 7: 63,758,552 D868Y probably damaging Het
Pcdhga6 T C 18: 37,708,013 L262S probably damaging Het
Plec C T 15: 76,172,532 V4402I possibly damaging Het
Ppp1r14c A T 10: 3,423,510 D107V probably damaging Het
Prkg1 A T 19: 30,586,367 C482S probably damaging Het
Prpf40a A T 2: 53,156,841 N294K probably benign Het
Rbpj A G 5: 53,645,874 Y148C probably damaging Het
Rnf19a A G 15: 36,241,668 S742P possibly damaging Het
Rnf207 T A 4: 152,311,438 Q533L probably damaging Het
Rsf1 A G 7: 97,661,958 T632A Het
Rtl1 C T 12: 109,593,921 V495I possibly damaging Het
Sh2d3c T A 2: 32,749,376 C491* probably null Het
Sik1 A T 17: 31,850,046 L285Q probably benign Het
Sipa1l1 T A 12: 82,341,568 D189E probably benign Het
Slc25a25 G A 2: 32,451,165 Q54* probably null Het
Sorbs3 T A 14: 70,193,916 N265I probably benign Het
Sspo A T 6: 48,463,310 E1645V probably benign Het
Swap70 A G 7: 110,221,875 D22G probably benign Het
Ttc34 T C 4: 154,861,300 C264R probably benign Het
Ttll2 T A 17: 7,352,091 T146S probably benign Het
Ttn C T 2: 76,927,204 E3402K unknown Het
Twf1 A T 15: 94,584,446 S140T probably benign Het
Vmn1r12 T C 6: 57,159,434 L172P probably damaging Het
Vmn1r19 T A 6: 57,404,679 N72K probably damaging Het
Vmn2r17 G A 5: 109,428,078 E272K probably benign Het
Zfpm2 A G 15: 41,102,612 D831G probably damaging Het
Other mutations in Copa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Copa APN 1 172110688 missense possibly damaging 0.87
IGL01360:Copa APN 1 172087588 unclassified probably null
IGL01434:Copa APN 1 172119561 missense probably benign 0.00
IGL01744:Copa APN 1 172113189 missense probably benign 0.01
IGL01837:Copa APN 1 172118852 missense probably benign 0.01
IGL01988:Copa APN 1 172118264 missense probably benign 0.09
IGL02059:Copa APN 1 172099753 missense probably damaging 0.96
IGL02123:Copa APN 1 172112128 missense probably damaging 1.00
IGL02731:Copa APN 1 172102218 missense possibly damaging 0.77
IGL03114:Copa APN 1 172119268 nonsense probably null
P0027:Copa UTSW 1 172111948 missense possibly damaging 0.87
PIT4434001:Copa UTSW 1 172106175 missense probably benign 0.00
R0233:Copa UTSW 1 172087667 critical splice donor site probably null
R0465:Copa UTSW 1 172118305 missense probably damaging 1.00
R0547:Copa UTSW 1 172121687 splice site probably benign
R0568:Copa UTSW 1 172112137 missense possibly damaging 0.91
R0628:Copa UTSW 1 172091025 splice site probably benign
R1328:Copa UTSW 1 172121691 splice site probably benign
R1494:Copa UTSW 1 172104127 missense probably benign 0.27
R1728:Copa UTSW 1 172111987 missense probably benign
R1758:Copa UTSW 1 172104144 missense probably damaging 1.00
R1784:Copa UTSW 1 172111987 missense probably benign
R1942:Copa UTSW 1 172111888 missense probably damaging 1.00
R2054:Copa UTSW 1 172118957 nonsense probably null
R2299:Copa UTSW 1 172121725 missense probably benign 0.10
R2518:Copa UTSW 1 172119901 missense probably benign
R2680:Copa UTSW 1 172121404 nonsense probably null
R3080:Copa UTSW 1 172113149 missense probably damaging 1.00
R3160:Copa UTSW 1 172091233 missense probably damaging 1.00
R3161:Copa UTSW 1 172091233 missense probably damaging 1.00
R3162:Copa UTSW 1 172091233 missense probably damaging 1.00
R3162:Copa UTSW 1 172091233 missense probably damaging 1.00
R3973:Copa UTSW 1 172121245 missense probably benign 0.00
R3975:Copa UTSW 1 172121245 missense probably benign 0.00
R4031:Copa UTSW 1 172108375 missense probably damaging 1.00
R4155:Copa UTSW 1 172101425 missense probably damaging 1.00
R4227:Copa UTSW 1 172118115 intron probably benign
R4244:Copa UTSW 1 172110718 missense probably benign 0.00
R4254:Copa UTSW 1 172102244 missense probably damaging 1.00
R4291:Copa UTSW 1 172092397 intron probably benign
R4323:Copa UTSW 1 172119264 missense probably damaging 1.00
R4402:Copa UTSW 1 172102224 missense probably damaging 1.00
R4711:Copa UTSW 1 172119988 missense probably damaging 1.00
R4721:Copa UTSW 1 172104274 splice site probably benign
R4773:Copa UTSW 1 172105220 missense probably damaging 1.00
R4794:Copa UTSW 1 172119321 missense probably damaging 1.00
R4887:Copa UTSW 1 172092276 missense probably benign 0.39
R4953:Copa UTSW 1 172082886 unclassified probably benign
R5139:Copa UTSW 1 172121329 missense probably damaging 0.99
R5152:Copa UTSW 1 172118061 missense probably benign 0.34
R5297:Copa UTSW 1 172113108 missense probably damaging 1.00
R5586:Copa UTSW 1 172105222 missense probably damaging 1.00
R5698:Copa UTSW 1 172118944 nonsense probably null
R6283:Copa UTSW 1 172118848 missense possibly damaging 0.79
R6921:Copa UTSW 1 172111924 missense possibly damaging 0.63
R6934:Copa UTSW 1 172110686 missense possibly damaging 0.64
R7009:Copa UTSW 1 172091000 missense probably damaging 0.96
R7194:Copa UTSW 1 172119944 missense probably damaging 0.99
R7348:Copa UTSW 1 172102223 missense possibly damaging 0.96
R7710:Copa UTSW 1 172109844 missense possibly damaging 0.50
R7745:Copa UTSW 1 172111942 missense probably damaging 1.00
R7976:Copa UTSW 1 172119565 nonsense probably null
T0722:Copa UTSW 1 172111948 missense possibly damaging 0.87
Z1177:Copa UTSW 1 172106123 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTTGGCAAGTTTGAGGAAGC -3'
(R):5'- CTCATGAGTGAGGACGACAG -3'

Sequencing Primer
(F):5'- TAGGAGGAGTCTAGCCACTTACTC -3'
(R):5'- CGACAGCGGAGAAATGGAAC -3'
Posted On2019-12-20