Incidental Mutation 'R7893:Cyp24a1'
ID609423
Institutional Source Beutler Lab
Gene Symbol Cyp24a1
Ensembl Gene ENSMUSG00000038567
Gene Namecytochrome P450, family 24, subfamily a, polypeptide 1
SynonymsCP24, 24-OHase, Cyp24, 25-hydroxyvitamin D-24-hydroxylase
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.392) question?
Stock #R7893 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location170482708-170497145 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to G at 170496516 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000047954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038824] [ENSMUST00000075087]
Predicted Effect probably null
Transcript: ENSMUST00000038824
SMART Domains Protein: ENSMUSP00000047954
Gene: ENSMUSG00000038567

DomainStartEndE-ValueType
Pfam:p450 58 511 6e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075087
SMART Domains Protein: ENSMUSP00000074596
Gene: ENSMUSG00000052033

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 69 1.9e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: The protein encoded by this gene localizes to the mitochondrion, where it degrades calcitriol to calcitetrol. This gene is upregulated by binding of calcitriol to the upstream regulatory region and to a downstream enhancer region, thereby allowing calcitriol to autoregulate its concentration in the cell. The encoded protein may also play a role in calcium homeostasis. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for disruption of this gene suffer a 50% mortality rate between birth and weaning. abnormalities are seen in the development of membranous bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,971,539 W291R probably damaging Het
9130019O22Rik T A 7: 127,386,544 probably benign Het
Abca3 A T 17: 24,385,466 I604F probably damaging Het
Adar T A 3: 89,750,651 D1062E probably damaging Het
Agap2 A G 10: 127,080,195 T192A unknown Het
Aim2 T C 1: 173,463,926 V299A possibly damaging Het
Arhgap33 T C 7: 30,528,776 I394V probably benign Het
Atg2a T C 19: 6,251,296 F800S probably damaging Het
Btnl10 T A 11: 58,923,809 N438K probably benign Het
C9 T A 15: 6,483,245 F283I possibly damaging Het
Camk2n2 T C 16: 20,621,076 N40S possibly damaging Het
Cd53 T A 3: 106,767,386 I122F probably benign Het
Col4a1 T C 8: 11,220,243 D45G unknown Het
Copa T A 1: 172,119,565 C1085* probably null Het
Cpt1b A G 15: 89,423,654 probably null Het
Cyp2c40 A T 19: 39,786,848 V320E probably damaging Het
Efcab7 A T 4: 99,888,861 D210V probably damaging Het
Elfn2 G A 15: 78,673,168 T393I probably damaging Het
Fbxw11 A T 11: 32,720,489 I152L probably benign Het
Gab1 A T 8: 80,784,766 F483L possibly damaging Het
Git2 G T 5: 114,769,676 R43S possibly damaging Het
Gm11639 A C 11: 104,979,360 S3985R unknown Het
Gm43302 G A 5: 105,289,025 Q72* probably null Het
Hcn2 T C 10: 79,724,411 L192P probably damaging Het
Htra4 A C 8: 25,033,679 F290C possibly damaging Het
Ide C T 19: 37,284,151 V731I Het
Igsf9 T C 1: 172,497,302 L929P probably damaging Het
Iqgap2 G A 13: 95,689,709 A535V probably damaging Het
Itga10 T C 3: 96,649,612 W217R probably damaging Het
Kdm2b A G 5: 122,947,739 F276L probably benign Het
Klf16 T C 10: 80,576,960 S81G probably benign Het
L1td1 G T 4: 98,733,741 C180F possibly damaging Het
Map4k2 A C 19: 6,353,511 H817P probably damaging Het
Marf1 A T 16: 14,146,735 V446D probably damaging Het
Mfsd4b1 A G 10: 40,007,317 S46P probably benign Het
Mylk G C 16: 34,879,524 S419T probably benign Het
Nckipsd A G 9: 108,815,389 H604R probably damaging Het
Nedd9 A T 13: 41,315,789 D629E probably damaging Het
Nlrp5 C T 7: 23,418,165 T438I probably benign Het
Olfr1238 T A 2: 89,407,070 Q3L probably benign Het
Olfr507 A G 7: 108,622,637 K275R probably damaging Het
Olfr610 A T 7: 103,506,610 I112N possibly damaging Het
Otud7a G T 7: 63,758,552 D868Y probably damaging Het
Pcdhga6 T C 18: 37,708,013 L262S probably damaging Het
Plec C T 15: 76,172,532 V4402I possibly damaging Het
Ppp1r14c A T 10: 3,423,510 D107V probably damaging Het
Prkg1 A T 19: 30,586,367 C482S probably damaging Het
Prpf40a A T 2: 53,156,841 N294K probably benign Het
Rbpj A G 5: 53,645,874 Y148C probably damaging Het
Rnf19a A G 15: 36,241,668 S742P possibly damaging Het
Rnf207 T A 4: 152,311,438 Q533L probably damaging Het
Rsf1 A G 7: 97,661,958 T632A Het
Rtl1 C T 12: 109,593,921 V495I possibly damaging Het
Sh2d3c T A 2: 32,749,376 C491* probably null Het
Sik1 A T 17: 31,850,046 L285Q probably benign Het
Sipa1l1 T A 12: 82,341,568 D189E probably benign Het
Slc25a25 G A 2: 32,451,165 Q54* probably null Het
Slu7 T C 11: 43,444,836 probably null Het
Sorbs3 T A 14: 70,193,916 N265I probably benign Het
Sspo A T 6: 48,463,310 E1645V probably benign Het
Swap70 A G 7: 110,221,875 D22G probably benign Het
Ttc34 T C 4: 154,861,300 C264R probably benign Het
Ttll2 T A 17: 7,352,091 T146S probably benign Het
Ttn C T 2: 76,927,204 E3402K unknown Het
Twf1 A T 15: 94,584,446 S140T probably benign Het
Vmn1r12 T C 6: 57,159,434 L172P probably damaging Het
Vmn1r19 T A 6: 57,404,679 N72K probably damaging Het
Vmn2r17 G A 5: 109,428,078 E272K probably benign Het
Zfpm2 A G 15: 41,102,612 D831G probably damaging Het
Other mutations in Cyp24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Cyp24a1 APN 2 170496566 missense probably damaging 1.00
IGL02187:Cyp24a1 APN 2 170494093 missense probably damaging 1.00
IGL02269:Cyp24a1 APN 2 170496572 missense probably damaging 1.00
IGL02273:Cyp24a1 APN 2 170496358 missense probably damaging 1.00
IGL03089:Cyp24a1 APN 2 170485966 missense probably damaging 1.00
R0359:Cyp24a1 UTSW 2 170491699 missense possibly damaging 0.94
R1037:Cyp24a1 UTSW 2 170491617 missense probably damaging 1.00
R1243:Cyp24a1 UTSW 2 170495406 missense probably benign 0.28
R1601:Cyp24a1 UTSW 2 170485691 missense possibly damaging 0.48
R1696:Cyp24a1 UTSW 2 170486043 missense probably benign 0.10
R1839:Cyp24a1 UTSW 2 170496741 missense probably benign
R1845:Cyp24a1 UTSW 2 170487917 missense probably benign 0.06
R4832:Cyp24a1 UTSW 2 170496178 missense probably benign 0.07
R5649:Cyp24a1 UTSW 2 170496309 missense possibly damaging 0.87
R6320:Cyp24a1 UTSW 2 170486784 missense probably benign 0.13
R6668:Cyp24a1 UTSW 2 170485885 critical splice donor site probably null
R6823:Cyp24a1 UTSW 2 170487979 missense probably benign 0.12
R6953:Cyp24a1 UTSW 2 170487946 missense probably benign
R7136:Cyp24a1 UTSW 2 170494143 missense probably benign 0.15
R7287:Cyp24a1 UTSW 2 170485906 missense probably damaging 1.00
R7831:Cyp24a1 UTSW 2 170485940 missense probably damaging 1.00
R8193:Cyp24a1 UTSW 2 170485702 missense probably damaging 1.00
R8206:Cyp24a1 UTSW 2 170491669 missense possibly damaging 0.83
R8296:Cyp24a1 UTSW 2 170490116 missense probably damaging 1.00
R8384:Cyp24a1 UTSW 2 170486769 critical splice donor site probably null
R9005:Cyp24a1 UTSW 2 170494085 missense probably damaging 1.00
X0061:Cyp24a1 UTSW 2 170485990 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGGCCATACTTCTTGTGGTAC -3'
(R):5'- TGCCCCATTGACAAAAGGC -3'

Sequencing Primer
(F):5'- TGTGGTACTCTGCCTGCAGC -3'
(R):5'- CAAGGTCCGTGACATCCAAGG -3'
Posted On2019-12-20