Incidental Mutation 'R7893:Cyp24a1'
ID 609423
Institutional Source Beutler Lab
Gene Symbol Cyp24a1
Ensembl Gene ENSMUSG00000038567
Gene Name cytochrome P450, family 24, subfamily a, polypeptide 1
Synonyms Cyp24, 25-hydroxyvitamin D-24-hydroxylase, CP24, 24-OHase
MMRRC Submission 045945-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.432) question?
Stock # R7893 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 170324877-170339065 bp(-) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to G at 170338436 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000047954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038824] [ENSMUST00000075087]
AlphaFold Q64441
Predicted Effect probably null
Transcript: ENSMUST00000038824
SMART Domains Protein: ENSMUSP00000047954
Gene: ENSMUSG00000038567

DomainStartEndE-ValueType
Pfam:p450 58 511 6e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075087
SMART Domains Protein: ENSMUSP00000074596
Gene: ENSMUSG00000052033

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 69 1.9e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: The protein encoded by this gene localizes to the mitochondrion, where it degrades calcitriol to calcitetrol. This gene is upregulated by binding of calcitriol to the upstream regulatory region and to a downstream enhancer region, thereby allowing calcitriol to autoregulate its concentration in the cell. The encoded protein may also play a role in calcium homeostasis. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for disruption of this gene suffer a 50% mortality rate between birth and weaning. abnormalities are seen in the development of membranous bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,604,440 (GRCm39) I604F probably damaging Het
Adar T A 3: 89,657,958 (GRCm39) D1062E probably damaging Het
Agap2 A G 10: 126,916,064 (GRCm39) T192A unknown Het
Aim2 T C 1: 173,291,492 (GRCm39) V299A possibly damaging Het
Arhgap33 T C 7: 30,228,201 (GRCm39) I394V probably benign Het
Atg2a T C 19: 6,301,326 (GRCm39) F800S probably damaging Het
Btnl10 T A 11: 58,814,635 (GRCm39) N438K probably benign Het
C9 T A 15: 6,512,726 (GRCm39) F283I possibly damaging Het
Camk2n2 T C 16: 20,439,826 (GRCm39) N40S possibly damaging Het
Cd53 T A 3: 106,674,702 (GRCm39) I122F probably benign Het
Col4a1 T C 8: 11,270,243 (GRCm39) D45G unknown Het
Copa T A 1: 171,947,132 (GRCm39) C1085* probably null Het
Cpt1b A G 15: 89,307,857 (GRCm39) probably null Het
Cyp2c40 A T 19: 39,775,292 (GRCm39) V320E probably damaging Het
Efcab3 A C 11: 104,870,186 (GRCm39) S3985R unknown Het
Efcab7 A T 4: 99,746,058 (GRCm39) D210V probably damaging Het
Elfn2 G A 15: 78,557,368 (GRCm39) T393I probably damaging Het
Fbxw11 A T 11: 32,670,489 (GRCm39) I152L probably benign Het
Gab1 A T 8: 81,511,395 (GRCm39) F483L possibly damaging Het
Git2 G T 5: 114,907,737 (GRCm39) R43S possibly damaging Het
Gm43302 G A 5: 105,436,891 (GRCm39) Q72* probably null Het
Hcn2 T C 10: 79,560,245 (GRCm39) L192P probably damaging Het
Htra4 A C 8: 25,523,695 (GRCm39) F290C possibly damaging Het
Ide C T 19: 37,261,550 (GRCm39) V731I Het
Igsf9 T C 1: 172,324,869 (GRCm39) L929P probably damaging Het
Iqgap2 G A 13: 95,826,217 (GRCm39) A535V probably damaging Het
Itga10 T C 3: 96,556,928 (GRCm39) W217R probably damaging Het
Kdm2b A G 5: 123,085,802 (GRCm39) F276L probably benign Het
Klf16 T C 10: 80,412,794 (GRCm39) S81G probably benign Het
L1td1 G T 4: 98,621,978 (GRCm39) C180F possibly damaging Het
Map4k2 A C 19: 6,403,541 (GRCm39) H817P probably damaging Het
Marf1 A T 16: 13,964,599 (GRCm39) V446D probably damaging Het
Mfsd4b1 A G 10: 39,883,313 (GRCm39) S46P probably benign Het
Mylk G C 16: 34,699,894 (GRCm39) S419T probably benign Het
Nckipsd A G 9: 108,692,588 (GRCm39) H604R probably damaging Het
Nedd9 A T 13: 41,469,265 (GRCm39) D629E probably damaging Het
Nlrp5 C T 7: 23,117,590 (GRCm39) T438I probably benign Het
Or4a39 T A 2: 89,237,414 (GRCm39) Q3L probably benign Het
Or51ag1 A T 7: 103,155,817 (GRCm39) I112N possibly damaging Het
Or5p79 A G 7: 108,221,844 (GRCm39) K275R probably damaging Het
Otud7a G T 7: 63,408,300 (GRCm39) D868Y probably damaging Het
Pcdhga6 T C 18: 37,841,066 (GRCm39) L262S probably damaging Het
Plec C T 15: 76,056,732 (GRCm39) V4402I possibly damaging Het
Ppp1r14c A T 10: 3,373,510 (GRCm39) D107V probably damaging Het
Prkg1 A T 19: 30,563,767 (GRCm39) C482S probably damaging Het
Prpf40a A T 2: 53,046,853 (GRCm39) N294K probably benign Het
Rbpj A G 5: 53,803,216 (GRCm39) Y148C probably damaging Het
Rnf19a A G 15: 36,241,814 (GRCm39) S742P possibly damaging Het
Rnf207 T A 4: 152,395,895 (GRCm39) Q533L probably damaging Het
Rsf1 A G 7: 97,311,165 (GRCm39) T632A Het
Rtl1 C T 12: 109,560,355 (GRCm39) V495I possibly damaging Het
Sh2d3c T A 2: 32,639,388 (GRCm39) C491* probably null Het
Sik1 A T 17: 32,069,020 (GRCm39) L285Q probably benign Het
Sipa1l1 T A 12: 82,388,342 (GRCm39) D189E probably benign Het
Slc25a25 G A 2: 32,341,177 (GRCm39) Q54* probably null Het
Slu7 T C 11: 43,335,663 (GRCm39) probably null Het
Sorbs3 T A 14: 70,431,365 (GRCm39) N265I probably benign Het
Spata31g1 T C 4: 42,971,539 (GRCm39) W291R probably damaging Het
Sspo A T 6: 48,440,244 (GRCm39) E1645V probably benign Het
Swap70 A G 7: 109,821,082 (GRCm39) D22G probably benign Het
Ttc34 T C 4: 154,945,757 (GRCm39) C264R probably benign Het
Ttll2 T A 17: 7,619,490 (GRCm39) T146S probably benign Het
Ttn C T 2: 76,757,548 (GRCm39) E3402K unknown Het
Twf1 A T 15: 94,482,327 (GRCm39) S140T probably benign Het
Vmn1r12 T C 6: 57,136,419 (GRCm39) L172P probably damaging Het
Vmn1r19 T A 6: 57,381,664 (GRCm39) N72K probably damaging Het
Vmn2r17 G A 5: 109,575,944 (GRCm39) E272K probably benign Het
Zfp747l1 T A 7: 126,985,716 (GRCm39) probably benign Het
Zfpm2 A G 15: 40,966,008 (GRCm39) D831G probably damaging Het
Other mutations in Cyp24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Cyp24a1 APN 2 170,338,486 (GRCm39) missense probably damaging 1.00
IGL02187:Cyp24a1 APN 2 170,336,013 (GRCm39) missense probably damaging 1.00
IGL02269:Cyp24a1 APN 2 170,338,492 (GRCm39) missense probably damaging 1.00
IGL02273:Cyp24a1 APN 2 170,338,278 (GRCm39) missense probably damaging 1.00
IGL03089:Cyp24a1 APN 2 170,327,886 (GRCm39) missense probably damaging 1.00
R0359:Cyp24a1 UTSW 2 170,333,619 (GRCm39) missense possibly damaging 0.94
R1037:Cyp24a1 UTSW 2 170,333,537 (GRCm39) missense probably damaging 1.00
R1243:Cyp24a1 UTSW 2 170,337,326 (GRCm39) missense probably benign 0.28
R1601:Cyp24a1 UTSW 2 170,327,611 (GRCm39) missense possibly damaging 0.48
R1696:Cyp24a1 UTSW 2 170,327,963 (GRCm39) missense probably benign 0.10
R1839:Cyp24a1 UTSW 2 170,338,661 (GRCm39) missense probably benign
R1845:Cyp24a1 UTSW 2 170,329,837 (GRCm39) missense probably benign 0.06
R4832:Cyp24a1 UTSW 2 170,338,098 (GRCm39) missense probably benign 0.07
R5649:Cyp24a1 UTSW 2 170,338,229 (GRCm39) missense possibly damaging 0.87
R6320:Cyp24a1 UTSW 2 170,328,704 (GRCm39) missense probably benign 0.13
R6668:Cyp24a1 UTSW 2 170,327,805 (GRCm39) critical splice donor site probably null
R6823:Cyp24a1 UTSW 2 170,329,899 (GRCm39) missense probably benign 0.12
R6953:Cyp24a1 UTSW 2 170,329,866 (GRCm39) missense probably benign
R7136:Cyp24a1 UTSW 2 170,336,063 (GRCm39) missense probably benign 0.15
R7287:Cyp24a1 UTSW 2 170,327,826 (GRCm39) missense probably damaging 1.00
R7831:Cyp24a1 UTSW 2 170,327,860 (GRCm39) missense probably damaging 1.00
R8193:Cyp24a1 UTSW 2 170,327,622 (GRCm39) missense probably damaging 1.00
R8206:Cyp24a1 UTSW 2 170,333,589 (GRCm39) missense possibly damaging 0.83
R8296:Cyp24a1 UTSW 2 170,332,036 (GRCm39) missense probably damaging 1.00
R8384:Cyp24a1 UTSW 2 170,328,689 (GRCm39) critical splice donor site probably null
R9005:Cyp24a1 UTSW 2 170,336,005 (GRCm39) missense probably damaging 1.00
R9091:Cyp24a1 UTSW 2 170,327,853 (GRCm39) missense probably damaging 1.00
R9226:Cyp24a1 UTSW 2 170,338,277 (GRCm39) missense probably damaging 1.00
R9270:Cyp24a1 UTSW 2 170,327,853 (GRCm39) missense probably damaging 1.00
R9776:Cyp24a1 UTSW 2 170,338,625 (GRCm39) missense probably benign 0.10
X0061:Cyp24a1 UTSW 2 170,327,910 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGGCCATACTTCTTGTGGTAC -3'
(R):5'- TGCCCCATTGACAAAAGGC -3'

Sequencing Primer
(F):5'- TGTGGTACTCTGCCTGCAGC -3'
(R):5'- CAAGGTCCGTGACATCCAAGG -3'
Posted On 2019-12-20