Incidental Mutation 'R7893:Ttc34'
ID609431
Institutional Source Beutler Lab
Gene Symbol Ttc34
Ensembl Gene ENSMUSG00000046637
Gene Nametetratricopeptide repeat domain 34
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R7893 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location154837459-154867127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 154861300 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 264 (C264R)
Ref Sequence ENSEMBL: ENSMUSP00000051782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050220] [ENSMUST00000207854]
Predicted Effect probably benign
Transcript: ENSMUST00000050220
AA Change: C264R

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000051782
Gene: ENSMUSG00000046637
AA Change: C264R

DomainStartEndE-ValueType
Blast:TPR 38 68 4e-6 BLAST
low complexity region 69 85 N/A INTRINSIC
TPR 166 199 2.66e0 SMART
TPR 200 233 4.45e-2 SMART
TPR 294 327 9e1 SMART
Blast:TPR 328 361 2e-7 BLAST
TPR 412 445 8.77e1 SMART
TPR 452 485 1.78e-1 SMART
Blast:TPR 500 533 9e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000207854
AA Change: C773R

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,971,539 W291R probably damaging Het
9130019O22Rik T A 7: 127,386,544 probably benign Het
Abca3 A T 17: 24,385,466 I604F probably damaging Het
Adar T A 3: 89,750,651 D1062E probably damaging Het
Agap2 A G 10: 127,080,195 T192A unknown Het
Aim2 T C 1: 173,463,926 V299A possibly damaging Het
Arhgap33 T C 7: 30,528,776 I394V probably benign Het
Atg2a T C 19: 6,251,296 F800S probably damaging Het
Btnl10 T A 11: 58,923,809 N438K probably benign Het
C9 T A 15: 6,483,245 F283I possibly damaging Het
Camk2n2 T C 16: 20,621,076 N40S possibly damaging Het
Cd53 T A 3: 106,767,386 I122F probably benign Het
Copa T A 1: 172,119,565 C1085* probably null Het
Cpt1b A G 15: 89,423,654 probably null Het
Cyp24a1 C G 2: 170,496,516 probably null Het
Cyp2c40 A T 19: 39,786,848 V320E probably damaging Het
Efcab7 A T 4: 99,888,861 D210V probably damaging Het
Elfn2 G A 15: 78,673,168 T393I probably damaging Het
Fbxw11 A T 11: 32,720,489 I152L probably benign Het
Gab1 A T 8: 80,784,766 F483L possibly damaging Het
Git2 G T 5: 114,769,676 R43S possibly damaging Het
Gm11639 A C 11: 104,979,360 S3985R unknown Het
Gm43302 G A 5: 105,289,025 Q72* probably null Het
Hcn2 T C 10: 79,724,411 L192P probably damaging Het
Htra4 A C 8: 25,033,679 F290C possibly damaging Het
Ide C T 19: 37,284,151 V731I Het
Igsf9 T C 1: 172,497,302 L929P probably damaging Het
Iqgap2 G A 13: 95,689,709 A535V probably damaging Het
Itga10 T C 3: 96,649,612 W217R probably damaging Het
Kdm2b A G 5: 122,947,739 F276L probably benign Het
Klf16 T C 10: 80,576,960 S81G probably benign Het
L1td1 G T 4: 98,733,741 C180F possibly damaging Het
Map4k2 A C 19: 6,353,511 H817P probably damaging Het
Marf1 A T 16: 14,146,735 V446D probably damaging Het
Mfsd4b1 A G 10: 40,007,317 S46P probably benign Het
Mylk G C 16: 34,879,524 S419T probably benign Het
Nckipsd A G 9: 108,815,389 H604R probably damaging Het
Nedd9 A T 13: 41,315,789 D629E probably damaging Het
Nlrp5 C T 7: 23,418,165 T438I probably benign Het
Olfr1238 T A 2: 89,407,070 Q3L probably benign Het
Olfr507 A G 7: 108,622,637 K275R probably damaging Het
Olfr610 A T 7: 103,506,610 I112N possibly damaging Het
Otud7a G T 7: 63,758,552 D868Y probably damaging Het
Pcdhga6 T C 18: 37,708,013 L262S probably damaging Het
Plec C T 15: 76,172,532 V4402I possibly damaging Het
Ppp1r14c A T 10: 3,423,510 D107V probably damaging Het
Prkg1 A T 19: 30,586,367 C482S probably damaging Het
Prpf40a A T 2: 53,156,841 N294K probably benign Het
Rbpj A G 5: 53,645,874 Y148C probably damaging Het
Rnf19a A G 15: 36,241,668 S742P possibly damaging Het
Rnf207 T A 4: 152,311,438 Q533L probably damaging Het
Rsf1 A G 7: 97,661,958 T632A Het
Rtl1 C T 12: 109,593,921 V495I possibly damaging Het
Sh2d3c T A 2: 32,749,376 C491* probably null Het
Sik1 A T 17: 31,850,046 L285Q probably benign Het
Sipa1l1 T A 12: 82,341,568 D189E probably benign Het
Slc25a25 G A 2: 32,451,165 Q54* probably null Het
Sorbs3 T A 14: 70,193,916 N265I probably benign Het
Sspo A T 6: 48,463,310 E1645V probably benign Het
Swap70 A G 7: 110,221,875 D22G probably benign Het
Ttll2 T A 17: 7,352,091 T146S probably benign Het
Ttn C T 2: 76,927,204 E3402K unknown Het
Twf1 A T 15: 94,584,446 S140T probably benign Het
Vmn1r12 T C 6: 57,159,434 L172P probably damaging Het
Vmn1r19 T A 6: 57,404,679 N72K probably damaging Het
Vmn2r17 G A 5: 109,428,078 E272K probably benign Het
Zfpm2 A G 15: 41,102,612 D831G probably damaging Het
Other mutations in Ttc34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03000:Ttc34 APN 4 154865431 missense probably damaging 1.00
IGL03034:Ttc34 APN 4 154861183 missense probably damaging 1.00
IGL03139:Ttc34 APN 4 154861270 missense probably benign 0.04
R1205:Ttc34 UTSW 4 154862214 missense probably benign 0.01
R1775:Ttc34 UTSW 4 154862214 missense probably benign 0.00
R1935:Ttc34 UTSW 4 154865682 missense possibly damaging 0.80
R1936:Ttc34 UTSW 4 154865682 missense possibly damaging 0.80
R1937:Ttc34 UTSW 4 154865682 missense possibly damaging 0.80
R1939:Ttc34 UTSW 4 154865682 missense possibly damaging 0.80
R1940:Ttc34 UTSW 4 154865682 missense possibly damaging 0.80
R3701:Ttc34 UTSW 4 154865482 missense probably damaging 1.00
R5181:Ttc34 UTSW 4 154862246 missense probably benign 0.00
R5845:Ttc34 UTSW 4 154865472 missense probably benign 0.08
R6603:Ttc34 UTSW 4 154839305 missense probably benign 0.34
R6930:Ttc34 UTSW 4 154839086 missense probably damaging 0.99
R7209:Ttc34 UTSW 4 154839128 missense probably damaging 1.00
R7548:Ttc34 UTSW 4 154856359 missense probably damaging 1.00
R7640:Ttc34 UTSW 4 154861384 missense probably benign
R7727:Ttc34 UTSW 4 154839274 missense possibly damaging 0.81
R7856:Ttc34 UTSW 4 154861286 missense probably benign
R7894:Ttc34 UTSW 4 154859383 missense probably damaging 1.00
R7939:Ttc34 UTSW 4 154861286 missense probably benign
R7976:Ttc34 UTSW 4 154861300 missense probably benign 0.05
R7977:Ttc34 UTSW 4 154859383 missense probably damaging 1.00
Z1177:Ttc34 UTSW 4 154865397 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TAGGCCATGGATAGTCGGAG -3'
(R):5'- AATGTGGCACAGAGACCCATG -3'

Sequencing Primer
(F):5'- ACTTTCTGAGTCTCCGGGGAG -3'
(R):5'- AGAGACCCATGTCCCCTG -3'
Posted On2019-12-20