Incidental Mutation 'R7893:Nckipsd'
ID609450
Institutional Source Beutler Lab
Gene Symbol Nckipsd
Ensembl Gene ENSMUSG00000032598
Gene NameNCK interacting protein with SH3 domain
SynonymsAF3P21, Wasbp, SPIN90, DIP1, WISH, ORF1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.465) question?
Stock #R7893 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location108808368-108818844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108815389 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 604 (H604R)
Ref Sequence ENSEMBL: ENSMUSP00000035218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035218] [ENSMUST00000194819] [ENSMUST00000195323]
Predicted Effect probably damaging
Transcript: ENSMUST00000035218
AA Change: H604R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035218
Gene: ENSMUSG00000032598
AA Change: H604R

DomainStartEndE-ValueType
SH3 1 57 2.21e-9 SMART
low complexity region 162 179 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 230 240 N/A INTRINSIC
low complexity region 249 271 N/A INTRINSIC
low complexity region 288 298 N/A INTRINSIC
Pfam:DUF2013 539 675 5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192678
Predicted Effect probably benign
Transcript: ENSMUST00000194819
SMART Domains Protein: ENSMUSP00000141702
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 52 3.3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195323
SMART Domains Protein: ENSMUSP00000141728
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 57 1.4e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is localized exclusively in the cell nucleus. It plays a role in signal transduction, and may function in the maintenance of sarcomeres and in the assembly of myofibrils into sarcomeres. It also plays an important role in stress fiber formation. The gene is involved in therapy-related leukemia by a chromosomal translocation t(3;11)(p21;q23) that involves this gene and the myeloid/lymphoid leukemia gene. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation exhibit altered protein composition of postsynaptic densities and actin cytoskeleton in hippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,971,539 W291R probably damaging Het
9130019O22Rik T A 7: 127,386,544 probably benign Het
Abca3 A T 17: 24,385,466 I604F probably damaging Het
Adar T A 3: 89,750,651 D1062E probably damaging Het
Agap2 A G 10: 127,080,195 T192A unknown Het
Aim2 T C 1: 173,463,926 V299A possibly damaging Het
Arhgap33 T C 7: 30,528,776 I394V probably benign Het
Atg2a T C 19: 6,251,296 F800S probably damaging Het
Btnl10 T A 11: 58,923,809 N438K probably benign Het
C9 T A 15: 6,483,245 F283I possibly damaging Het
Camk2n2 T C 16: 20,621,076 N40S possibly damaging Het
Cd53 T A 3: 106,767,386 I122F probably benign Het
Col4a1 T C 8: 11,220,243 D45G unknown Het
Copa T A 1: 172,119,565 C1085* probably null Het
Cpt1b A G 15: 89,423,654 probably null Het
Cyp24a1 C G 2: 170,496,516 probably null Het
Cyp2c40 A T 19: 39,786,848 V320E probably damaging Het
Efcab7 A T 4: 99,888,861 D210V probably damaging Het
Elfn2 G A 15: 78,673,168 T393I probably damaging Het
Fbxw11 A T 11: 32,720,489 I152L probably benign Het
Gab1 A T 8: 80,784,766 F483L possibly damaging Het
Git2 G T 5: 114,769,676 R43S possibly damaging Het
Gm11639 A C 11: 104,979,360 S3985R unknown Het
Gm43302 G A 5: 105,289,025 Q72* probably null Het
Hcn2 T C 10: 79,724,411 L192P probably damaging Het
Htra4 A C 8: 25,033,679 F290C possibly damaging Het
Ide C T 19: 37,284,151 V731I Het
Igsf9 T C 1: 172,497,302 L929P probably damaging Het
Iqgap2 G A 13: 95,689,709 A535V probably damaging Het
Itga10 T C 3: 96,649,612 W217R probably damaging Het
Kdm2b A G 5: 122,947,739 F276L probably benign Het
Klf16 T C 10: 80,576,960 S81G probably benign Het
L1td1 G T 4: 98,733,741 C180F possibly damaging Het
Map4k2 A C 19: 6,353,511 H817P probably damaging Het
Marf1 A T 16: 14,146,735 V446D probably damaging Het
Mfsd4b1 A G 10: 40,007,317 S46P probably benign Het
Mylk G C 16: 34,879,524 S419T probably benign Het
Nedd9 A T 13: 41,315,789 D629E probably damaging Het
Nlrp5 C T 7: 23,418,165 T438I probably benign Het
Olfr1238 T A 2: 89,407,070 Q3L probably benign Het
Olfr507 A G 7: 108,622,637 K275R probably damaging Het
Olfr610 A T 7: 103,506,610 I112N possibly damaging Het
Otud7a G T 7: 63,758,552 D868Y probably damaging Het
Pcdhga6 T C 18: 37,708,013 L262S probably damaging Het
Plec C T 15: 76,172,532 V4402I possibly damaging Het
Ppp1r14c A T 10: 3,423,510 D107V probably damaging Het
Prkg1 A T 19: 30,586,367 C482S probably damaging Het
Prpf40a A T 2: 53,156,841 N294K probably benign Het
Rbpj A G 5: 53,645,874 Y148C probably damaging Het
Rnf19a A G 15: 36,241,668 S742P possibly damaging Het
Rnf207 T A 4: 152,311,438 Q533L probably damaging Het
Rsf1 A G 7: 97,661,958 T632A Het
Rtl1 C T 12: 109,593,921 V495I possibly damaging Het
Sh2d3c T A 2: 32,749,376 C491* probably null Het
Sik1 A T 17: 31,850,046 L285Q probably benign Het
Sipa1l1 T A 12: 82,341,568 D189E probably benign Het
Slc25a25 G A 2: 32,451,165 Q54* probably null Het
Slu7 T C 11: 43,444,836 probably null Het
Sorbs3 T A 14: 70,193,916 N265I probably benign Het
Sspo A T 6: 48,463,310 E1645V probably benign Het
Swap70 A G 7: 110,221,875 D22G probably benign Het
Ttc34 T C 4: 154,861,300 C264R probably benign Het
Ttll2 T A 17: 7,352,091 T146S probably benign Het
Ttn C T 2: 76,927,204 E3402K unknown Het
Twf1 A T 15: 94,584,446 S140T probably benign Het
Vmn1r12 T C 6: 57,159,434 L172P probably damaging Het
Vmn1r19 T A 6: 57,404,679 N72K probably damaging Het
Vmn2r17 G A 5: 109,428,078 E272K probably benign Het
Zfpm2 A G 15: 41,102,612 D831G probably damaging Het
Other mutations in Nckipsd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Nckipsd APN 9 108814969 missense probably benign 0.07
IGL01601:Nckipsd APN 9 108813955 missense probably benign 0.00
IGL01809:Nckipsd APN 9 108817554 missense probably damaging 1.00
IGL03229:Nckipsd APN 9 108811614 missense probably benign
R0714:Nckipsd UTSW 9 108814134 unclassified probably benign
R1323:Nckipsd UTSW 9 108812579 missense probably damaging 1.00
R1323:Nckipsd UTSW 9 108812579 missense probably damaging 1.00
R1543:Nckipsd UTSW 9 108812372 missense possibly damaging 0.62
R1958:Nckipsd UTSW 9 108814664 splice site probably null
R2127:Nckipsd UTSW 9 108811733 missense probably benign
R3697:Nckipsd UTSW 9 108811121 missense probably damaging 1.00
R3698:Nckipsd UTSW 9 108811121 missense probably damaging 1.00
R3921:Nckipsd UTSW 9 108814076 missense possibly damaging 0.81
R4755:Nckipsd UTSW 9 108814739 missense probably benign 0.28
R4879:Nckipsd UTSW 9 108813915 unclassified probably benign
R5796:Nckipsd UTSW 9 108811614 missense probably benign
R5891:Nckipsd UTSW 9 108808609 missense probably damaging 1.00
R5943:Nckipsd UTSW 9 108812236 missense possibly damaging 0.54
R5994:Nckipsd UTSW 9 108813977 missense probably benign 0.00
R6144:Nckipsd UTSW 9 108812386 missense probably damaging 1.00
R6403:Nckipsd UTSW 9 108811683 missense possibly damaging 0.71
R7413:Nckipsd UTSW 9 108814081 missense probably benign 0.30
R7676:Nckipsd UTSW 9 108814954 missense probably damaging 1.00
R7702:Nckipsd UTSW 9 108814017 nonsense probably null
R8257:Nckipsd UTSW 9 108814928 missense probably benign 0.10
Y4335:Nckipsd UTSW 9 108817545 missense probably damaging 1.00
Z1088:Nckipsd UTSW 9 108814677 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTCCTGAGCAGAATGTCATCATG -3'
(R):5'- GTCACCCCTTTTGGTTAAGCTG -3'

Sequencing Primer
(F):5'- AGAATGTCATCATGGCTGCC -3'
(R):5'- CCCCTTTTGGTTAAGCTGCTGTG -3'
Posted On2019-12-20