Incidental Mutation 'R7893:Nckipsd'
ID 609450
Institutional Source Beutler Lab
Gene Symbol Nckipsd
Ensembl Gene ENSMUSG00000032598
Gene Name NCK interacting protein with SH3 domain
Synonyms ORF1, DIP1, Wasbp, SPIN90, AF3P21, WISH
MMRRC Submission 045945-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.438) question?
Stock # R7893 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 108685567-108696043 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 108692588 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 604 (H604R)
Ref Sequence ENSEMBL: ENSMUSP00000035218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035218] [ENSMUST00000194819] [ENSMUST00000195323]
AlphaFold Q9ESJ4
Predicted Effect probably damaging
Transcript: ENSMUST00000035218
AA Change: H604R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035218
Gene: ENSMUSG00000032598
AA Change: H604R

DomainStartEndE-ValueType
SH3 1 57 2.21e-9 SMART
low complexity region 162 179 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 230 240 N/A INTRINSIC
low complexity region 249 271 N/A INTRINSIC
low complexity region 288 298 N/A INTRINSIC
Pfam:DUF2013 539 675 5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192678
Predicted Effect probably benign
Transcript: ENSMUST00000194819
SMART Domains Protein: ENSMUSP00000141702
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 52 3.3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195323
SMART Domains Protein: ENSMUSP00000141728
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 57 1.4e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is localized exclusively in the cell nucleus. It plays a role in signal transduction, and may function in the maintenance of sarcomeres and in the assembly of myofibrils into sarcomeres. It also plays an important role in stress fiber formation. The gene is involved in therapy-related leukemia by a chromosomal translocation t(3;11)(p21;q23) that involves this gene and the myeloid/lymphoid leukemia gene. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation exhibit altered protein composition of postsynaptic densities and actin cytoskeleton in hippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,604,440 (GRCm39) I604F probably damaging Het
Adar T A 3: 89,657,958 (GRCm39) D1062E probably damaging Het
Agap2 A G 10: 126,916,064 (GRCm39) T192A unknown Het
Aim2 T C 1: 173,291,492 (GRCm39) V299A possibly damaging Het
Arhgap33 T C 7: 30,228,201 (GRCm39) I394V probably benign Het
Atg2a T C 19: 6,301,326 (GRCm39) F800S probably damaging Het
Btnl10 T A 11: 58,814,635 (GRCm39) N438K probably benign Het
C9 T A 15: 6,512,726 (GRCm39) F283I possibly damaging Het
Camk2n2 T C 16: 20,439,826 (GRCm39) N40S possibly damaging Het
Cd53 T A 3: 106,674,702 (GRCm39) I122F probably benign Het
Col4a1 T C 8: 11,270,243 (GRCm39) D45G unknown Het
Copa T A 1: 171,947,132 (GRCm39) C1085* probably null Het
Cpt1b A G 15: 89,307,857 (GRCm39) probably null Het
Cyp24a1 C G 2: 170,338,436 (GRCm39) probably null Het
Cyp2c40 A T 19: 39,775,292 (GRCm39) V320E probably damaging Het
Efcab3 A C 11: 104,870,186 (GRCm39) S3985R unknown Het
Efcab7 A T 4: 99,746,058 (GRCm39) D210V probably damaging Het
Elfn2 G A 15: 78,557,368 (GRCm39) T393I probably damaging Het
Fbxw11 A T 11: 32,670,489 (GRCm39) I152L probably benign Het
Gab1 A T 8: 81,511,395 (GRCm39) F483L possibly damaging Het
Git2 G T 5: 114,907,737 (GRCm39) R43S possibly damaging Het
Gm43302 G A 5: 105,436,891 (GRCm39) Q72* probably null Het
Hcn2 T C 10: 79,560,245 (GRCm39) L192P probably damaging Het
Htra4 A C 8: 25,523,695 (GRCm39) F290C possibly damaging Het
Ide C T 19: 37,261,550 (GRCm39) V731I Het
Igsf9 T C 1: 172,324,869 (GRCm39) L929P probably damaging Het
Iqgap2 G A 13: 95,826,217 (GRCm39) A535V probably damaging Het
Itga10 T C 3: 96,556,928 (GRCm39) W217R probably damaging Het
Kdm2b A G 5: 123,085,802 (GRCm39) F276L probably benign Het
Klf16 T C 10: 80,412,794 (GRCm39) S81G probably benign Het
L1td1 G T 4: 98,621,978 (GRCm39) C180F possibly damaging Het
Map4k2 A C 19: 6,403,541 (GRCm39) H817P probably damaging Het
Marf1 A T 16: 13,964,599 (GRCm39) V446D probably damaging Het
Mfsd4b1 A G 10: 39,883,313 (GRCm39) S46P probably benign Het
Mylk G C 16: 34,699,894 (GRCm39) S419T probably benign Het
Nedd9 A T 13: 41,469,265 (GRCm39) D629E probably damaging Het
Nlrp5 C T 7: 23,117,590 (GRCm39) T438I probably benign Het
Or4a39 T A 2: 89,237,414 (GRCm39) Q3L probably benign Het
Or51ag1 A T 7: 103,155,817 (GRCm39) I112N possibly damaging Het
Or5p79 A G 7: 108,221,844 (GRCm39) K275R probably damaging Het
Otud7a G T 7: 63,408,300 (GRCm39) D868Y probably damaging Het
Pcdhga6 T C 18: 37,841,066 (GRCm39) L262S probably damaging Het
Plec C T 15: 76,056,732 (GRCm39) V4402I possibly damaging Het
Ppp1r14c A T 10: 3,373,510 (GRCm39) D107V probably damaging Het
Prkg1 A T 19: 30,563,767 (GRCm39) C482S probably damaging Het
Prpf40a A T 2: 53,046,853 (GRCm39) N294K probably benign Het
Rbpj A G 5: 53,803,216 (GRCm39) Y148C probably damaging Het
Rnf19a A G 15: 36,241,814 (GRCm39) S742P possibly damaging Het
Rnf207 T A 4: 152,395,895 (GRCm39) Q533L probably damaging Het
Rsf1 A G 7: 97,311,165 (GRCm39) T632A Het
Rtl1 C T 12: 109,560,355 (GRCm39) V495I possibly damaging Het
Sh2d3c T A 2: 32,639,388 (GRCm39) C491* probably null Het
Sik1 A T 17: 32,069,020 (GRCm39) L285Q probably benign Het
Sipa1l1 T A 12: 82,388,342 (GRCm39) D189E probably benign Het
Slc25a25 G A 2: 32,341,177 (GRCm39) Q54* probably null Het
Slu7 T C 11: 43,335,663 (GRCm39) probably null Het
Sorbs3 T A 14: 70,431,365 (GRCm39) N265I probably benign Het
Spata31g1 T C 4: 42,971,539 (GRCm39) W291R probably damaging Het
Sspo A T 6: 48,440,244 (GRCm39) E1645V probably benign Het
Swap70 A G 7: 109,821,082 (GRCm39) D22G probably benign Het
Ttc34 T C 4: 154,945,757 (GRCm39) C264R probably benign Het
Ttll2 T A 17: 7,619,490 (GRCm39) T146S probably benign Het
Ttn C T 2: 76,757,548 (GRCm39) E3402K unknown Het
Twf1 A T 15: 94,482,327 (GRCm39) S140T probably benign Het
Vmn1r12 T C 6: 57,136,419 (GRCm39) L172P probably damaging Het
Vmn1r19 T A 6: 57,381,664 (GRCm39) N72K probably damaging Het
Vmn2r17 G A 5: 109,575,944 (GRCm39) E272K probably benign Het
Zfp747l1 T A 7: 126,985,716 (GRCm39) probably benign Het
Zfpm2 A G 15: 40,966,008 (GRCm39) D831G probably damaging Het
Other mutations in Nckipsd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Nckipsd APN 9 108,692,168 (GRCm39) missense probably benign 0.07
IGL01601:Nckipsd APN 9 108,691,154 (GRCm39) missense probably benign 0.00
IGL01809:Nckipsd APN 9 108,694,753 (GRCm39) missense probably damaging 1.00
IGL03229:Nckipsd APN 9 108,688,813 (GRCm39) missense probably benign
R0714:Nckipsd UTSW 9 108,691,333 (GRCm39) unclassified probably benign
R1323:Nckipsd UTSW 9 108,689,778 (GRCm39) missense probably damaging 1.00
R1323:Nckipsd UTSW 9 108,689,778 (GRCm39) missense probably damaging 1.00
R1543:Nckipsd UTSW 9 108,689,571 (GRCm39) missense possibly damaging 0.62
R1958:Nckipsd UTSW 9 108,691,863 (GRCm39) splice site probably null
R2127:Nckipsd UTSW 9 108,688,932 (GRCm39) missense probably benign
R3697:Nckipsd UTSW 9 108,688,320 (GRCm39) missense probably damaging 1.00
R3698:Nckipsd UTSW 9 108,688,320 (GRCm39) missense probably damaging 1.00
R3921:Nckipsd UTSW 9 108,691,275 (GRCm39) missense possibly damaging 0.81
R4755:Nckipsd UTSW 9 108,691,938 (GRCm39) missense probably benign 0.28
R4879:Nckipsd UTSW 9 108,691,114 (GRCm39) unclassified probably benign
R5796:Nckipsd UTSW 9 108,688,813 (GRCm39) missense probably benign
R5891:Nckipsd UTSW 9 108,685,808 (GRCm39) missense probably damaging 1.00
R5943:Nckipsd UTSW 9 108,689,435 (GRCm39) missense possibly damaging 0.54
R5994:Nckipsd UTSW 9 108,691,176 (GRCm39) missense probably benign 0.00
R6144:Nckipsd UTSW 9 108,689,585 (GRCm39) missense probably damaging 1.00
R6403:Nckipsd UTSW 9 108,688,882 (GRCm39) missense possibly damaging 0.71
R7413:Nckipsd UTSW 9 108,691,280 (GRCm39) missense probably benign 0.30
R7676:Nckipsd UTSW 9 108,692,153 (GRCm39) missense probably damaging 1.00
R7702:Nckipsd UTSW 9 108,691,216 (GRCm39) nonsense probably null
R8257:Nckipsd UTSW 9 108,692,127 (GRCm39) missense probably benign 0.10
R9327:Nckipsd UTSW 9 108,691,699 (GRCm39) missense possibly damaging 0.49
R9353:Nckipsd UTSW 9 108,691,471 (GRCm39) missense probably damaging 0.99
R9484:Nckipsd UTSW 9 108,689,837 (GRCm39) missense probably damaging 1.00
Y4335:Nckipsd UTSW 9 108,694,744 (GRCm39) missense probably damaging 1.00
Z1088:Nckipsd UTSW 9 108,691,876 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTCCTGAGCAGAATGTCATCATG -3'
(R):5'- GTCACCCCTTTTGGTTAAGCTG -3'

Sequencing Primer
(F):5'- AGAATGTCATCATGGCTGCC -3'
(R):5'- CCCCTTTTGGTTAAGCTGCTGTG -3'
Posted On 2019-12-20