Incidental Mutation 'R0141:Def8'
ID60946
Institutional Source Beutler Lab
Gene Symbol Def8
Ensembl Gene ENSMUSG00000001482
Gene Namedifferentially expressed in FDCP 8
SynonymsD8Ertd713e
MMRRC Submission 038426-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R0141 (G1)
Quality Score126
Status Not validated
Chromosome8
Chromosomal Location123423527-123463270 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 123456495 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 278 (A278T)
Ref Sequence ENSEMBL: ENSMUSP00000104460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001522] [ENSMUST00000065534] [ENSMUST00000093049] [ENSMUST00000108830] [ENSMUST00000108832] [ENSMUST00000124741] [ENSMUST00000127664] [ENSMUST00000128424] [ENSMUST00000132063] [ENSMUST00000212391] [ENSMUST00000212827] [ENSMUST00000212883]
Predicted Effect probably damaging
Transcript: ENSMUST00000001522
AA Change: A266T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000001522
Gene: ENSMUSG00000001482
AA Change: A266T

DomainStartEndE-ValueType
Blast:DUF4206 77 133 8e-28 BLAST
C1 148 198 4.12e-3 SMART
DUF4206 243 447 4.01e-121 SMART
C1 385 437 1.5e0 SMART
RING 399 440 4.86e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000065534
AA Change: A254T

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000070579
Gene: ENSMUSG00000001482
AA Change: A254T

DomainStartEndE-ValueType
Blast:DUF4206 65 121 7e-28 BLAST
C1 136 186 4.12e-3 SMART
DUF4206 231 435 4.01e-121 SMART
C1 373 425 1.5e0 SMART
RING 387 428 4.86e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000093049
AA Change: A254T

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000090737
Gene: ENSMUSG00000001482
AA Change: A254T

DomainStartEndE-ValueType
Blast:DUF4206 65 121 9e-28 BLAST
C1 136 186 4.12e-3 SMART
DUF4206 231 429 6.85e-106 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108830
AA Change: A254T

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104458
Gene: ENSMUSG00000001482
AA Change: A254T

DomainStartEndE-ValueType
Blast:DUF4206 65 121 7e-28 BLAST
C1 136 186 4.12e-3 SMART
DUF4206 231 435 4.01e-121 SMART
C1 373 425 1.5e0 SMART
RING 387 428 4.86e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108832
AA Change: A278T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104460
Gene: ENSMUSG00000001482
AA Change: A278T

DomainStartEndE-ValueType
Blast:DUF4206 89 145 9e-28 BLAST
C1 160 210 4.12e-3 SMART
DUF4206 255 459 4.01e-121 SMART
C1 397 449 1.5e0 SMART
RING 411 452 4.86e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124741
SMART Domains Protein: ENSMUSP00000122532
Gene: ENSMUSG00000001482

DomainStartEndE-ValueType
Blast:DUF4206 65 97 4e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128424
SMART Domains Protein: ENSMUSP00000115137
Gene: ENSMUSG00000001482

DomainStartEndE-ValueType
Blast:DUF4206 77 133 4e-30 BLAST
C1 148 198 4.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132063
Predicted Effect probably benign
Transcript: ENSMUST00000212391
Predicted Effect probably benign
Transcript: ENSMUST00000212827
Predicted Effect probably benign
Transcript: ENSMUST00000212883
Meta Mutation Damage Score 0.8511 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.9%
Validation Efficiency 88% (50/57)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,683,782 N772K probably benign Het
Acot12 A C 13: 91,771,828 D294A probably benign Het
Adamts9 T C 6: 92,943,085 D24G probably benign Het
Ahnak G A 19: 9,006,680 G1776D probably damaging Het
Arfgef3 C A 10: 18,597,407 C1636F probably damaging Het
AW551984 A G 9: 39,590,644 L722P probably damaging Het
Ccndbp1 T A 2: 121,012,422 M188K probably damaging Het
Col27a1 A T 4: 63,265,633 probably null Het
Cpt1c A G 7: 44,966,671 Y306H probably damaging Het
Cyp3a57 A G 5: 145,362,102 I71V probably benign Het
Dmrt2 A T 19: 25,678,291 Q418L possibly damaging Het
Ebf1 T C 11: 44,908,000 L284S probably damaging Het
Fam131a G A 16: 20,698,988 A15T probably benign Het
Fbxo17 A G 7: 28,733,491 T146A possibly damaging Het
Fer1l6 A G 15: 58,558,402 E226G probably damaging Het
Galnt18 A T 7: 111,599,031 I174N probably damaging Het
Gm13088 T C 4: 143,654,568 Y295C probably benign Het
Gm44501 T C 17: 40,578,853 I86T probably benign Het
Gm884 A C 11: 103,613,686 I2485M probably damaging Het
Gtsf1l T C 2: 163,087,326 Q79R probably benign Het
Hapln4 T C 8: 70,088,280 L321P probably damaging Het
Herc2 A G 7: 56,121,561 T1024A probably benign Het
Hps5 A G 7: 46,789,181 S43P probably damaging Het
Igsf10 A G 3: 59,330,832 Y643H probably damaging Het
Lama4 G A 10: 39,092,278 R1472H probably benign Het
Lhx9 A G 1: 138,840,006 Y73H possibly damaging Het
Loxl1 T A 9: 58,312,132 Q252L probably damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nr3c2 T A 8: 76,908,408 V46D probably damaging Het
Olfr1283 T A 2: 111,369,490 I286N probably damaging Het
Olfr152 C G 2: 87,782,705 P55R possibly damaging Het
Olfr487 A C 7: 108,212,003 N175K possibly damaging Het
Olfr495 A T 7: 108,395,368 N83Y probably benign Het
Olfr749 T C 14: 50,736,383 S260G possibly damaging Het
Osbp T C 19: 11,973,859 V256A possibly damaging Het
Pclo A T 5: 14,791,922 D4737V unknown Het
Pkdrej A G 15: 85,815,630 I2035T probably damaging Het
Plek2 A G 12: 78,894,504 S185P probably damaging Het
Pnpla6 G T 8: 3,532,117 probably null Het
Pou3f2 T C 4: 22,487,210 T308A possibly damaging Het
Pxmp4 A G 2: 154,592,295 V82A probably damaging Het
Rnf6 A T 5: 146,211,835 N135K possibly damaging Het
Rtl1 A G 12: 109,592,948 V819A probably damaging Het
Scn1a C A 2: 66,289,062 V1355L probably damaging Het
Scn2a T A 2: 65,711,816 N754K probably benign Het
Serpina3b A T 12: 104,130,771 N104Y probably damaging Het
Sh3rf2 T C 18: 42,156,057 S648P probably benign Het
Slc17a6 G A 7: 51,669,067 V486I probably benign Het
Syne2 T G 12: 75,941,298 D1743E probably damaging Het
Tex14 T G 11: 87,493,031 probably null Het
Tfb1m T C 17: 3,554,957 D87G probably damaging Het
Tll2 C T 19: 41,097,912 G609S probably damaging Het
Tsc22d2 A T 3: 58,417,156 probably benign Het
Tsen2 A G 6: 115,568,829 D360G probably damaging Het
Ugt2b37 G A 5: 87,240,983 P457L probably damaging Het
Vmn1r68 T C 7: 10,527,325 N282S possibly damaging Het
Vmn2r58 G A 7: 41,861,885 S498F probably benign Het
Zfp959 T C 17: 55,898,139 I392T probably benign Het
Other mutations in Def8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Def8 APN 8 123459650 missense possibly damaging 0.95
IGL01896:Def8 APN 8 123459895 missense probably benign 0.29
IGL02424:Def8 APN 8 123459648 missense possibly damaging 0.65
IGL02982:Def8 APN 8 123456539 unclassified probably benign
IGL03218:Def8 APN 8 123456436 missense probably damaging 1.00
defensive UTSW 8 123454322 missense probably damaging 1.00
PIT4495001:Def8 UTSW 8 123459553 missense probably benign 0.00
R0003:Def8 UTSW 8 123456495 missense probably damaging 0.98
R0117:Def8 UTSW 8 123456495 missense probably damaging 0.98
R0119:Def8 UTSW 8 123456495 missense probably damaging 0.98
R0135:Def8 UTSW 8 123456495 missense probably damaging 0.98
R0138:Def8 UTSW 8 123456495 missense probably damaging 0.98
R0408:Def8 UTSW 8 123459917 missense probably damaging 1.00
R0636:Def8 UTSW 8 123454357 nonsense probably null
R3890:Def8 UTSW 8 123458344 unclassified probably benign
R3891:Def8 UTSW 8 123458344 unclassified probably benign
R3892:Def8 UTSW 8 123458344 unclassified probably benign
R4904:Def8 UTSW 8 123461480 missense probably damaging 0.96
R5930:Def8 UTSW 8 123460070 unclassified probably benign
R6088:Def8 UTSW 8 123460048 nonsense probably null
R6577:Def8 UTSW 8 123456710 missense probably benign 0.01
R7446:Def8 UTSW 8 123454322 missense probably damaging 1.00
R7498:Def8 UTSW 8 123447844 missense probably damaging 1.00
R7770:Def8 UTSW 8 123460059 missense unknown
R7827:Def8 UTSW 8 123447321 missense probably benign
R8186:Def8 UTSW 8 123461476 nonsense probably null
R8256:Def8 UTSW 8 123459629 missense probably damaging 1.00
Z1088:Def8 UTSW 8 123456498 missense probably damaging 0.96
Z1176:Def8 UTSW 8 123459966 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TCATTGGGAGAACCCCTAGCACAG -3'
(R):5'- TAGCTGAGTGACCAGCTTGCAGAG -3'

Sequencing Primer
(F):5'- AGATCCATACGATGTGAGTCCTTG -3'
(R):5'- CAGCTTGCAGAGCTAGGACTG -3'
Posted On2013-07-24