Incidental Mutation 'R7893:Iqgap2'
ID609462
Institutional Source Beutler Lab
Gene Symbol Iqgap2
Ensembl Gene ENSMUSG00000021676
Gene NameIQ motif containing GTPase activating protein 2
Synonyms4933417J23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7893 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location95627177-95891922 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 95689709 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 535 (A535V)
Ref Sequence ENSEMBL: ENSMUSP00000067685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068603]
Predicted Effect probably damaging
Transcript: ENSMUST00000068603
AA Change: A535V

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000067685
Gene: ENSMUSG00000021676
AA Change: A535V

DomainStartEndE-ValueType
CH 43 152 3.32e-16 SMART
coiled coil region 253 276 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
IQ 689 711 1.38e-4 SMART
IQ 719 741 7.36e0 SMART
IQ 749 771 2.43e1 SMART
coiled coil region 799 828 N/A INTRINSIC
RasGAP 905 1258 2.6e-120 SMART
Pfam:RasGAP_C 1367 1498 3.2e-40 PFAM
Meta Mutation Damage Score 0.1707 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains three IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display reduced survival with increased incidence of hepatocellular carcinomas, increased hepatocyte apoptosis, and hepatocyte mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,971,539 W291R probably damaging Het
9130019O22Rik T A 7: 127,386,544 probably benign Het
Abca3 A T 17: 24,385,466 I604F probably damaging Het
Adar T A 3: 89,750,651 D1062E probably damaging Het
Agap2 A G 10: 127,080,195 T192A unknown Het
Aim2 T C 1: 173,463,926 V299A possibly damaging Het
Arhgap33 T C 7: 30,528,776 I394V probably benign Het
Atg2a T C 19: 6,251,296 F800S probably damaging Het
Btnl10 T A 11: 58,923,809 N438K probably benign Het
C9 T A 15: 6,483,245 F283I possibly damaging Het
Camk2n2 T C 16: 20,621,076 N40S possibly damaging Het
Cd53 T A 3: 106,767,386 I122F probably benign Het
Col4a1 T C 8: 11,220,243 D45G unknown Het
Copa T A 1: 172,119,565 C1085* probably null Het
Cpt1b A G 15: 89,423,654 probably null Het
Cyp24a1 C G 2: 170,496,516 probably null Het
Cyp2c40 A T 19: 39,786,848 V320E probably damaging Het
Efcab7 A T 4: 99,888,861 D210V probably damaging Het
Elfn2 G A 15: 78,673,168 T393I probably damaging Het
Fbxw11 A T 11: 32,720,489 I152L probably benign Het
Gab1 A T 8: 80,784,766 F483L possibly damaging Het
Git2 G T 5: 114,769,676 R43S possibly damaging Het
Gm11639 A C 11: 104,979,360 S3985R unknown Het
Gm43302 G A 5: 105,289,025 Q72* probably null Het
Hcn2 T C 10: 79,724,411 L192P probably damaging Het
Htra4 A C 8: 25,033,679 F290C possibly damaging Het
Ide C T 19: 37,284,151 V731I Het
Igsf9 T C 1: 172,497,302 L929P probably damaging Het
Itga10 T C 3: 96,649,612 W217R probably damaging Het
Kdm2b A G 5: 122,947,739 F276L probably benign Het
Klf16 T C 10: 80,576,960 S81G probably benign Het
L1td1 G T 4: 98,733,741 C180F possibly damaging Het
Map4k2 A C 19: 6,353,511 H817P probably damaging Het
Marf1 A T 16: 14,146,735 V446D probably damaging Het
Mfsd4b1 A G 10: 40,007,317 S46P probably benign Het
Mylk G C 16: 34,879,524 S419T probably benign Het
Nckipsd A G 9: 108,815,389 H604R probably damaging Het
Nedd9 A T 13: 41,315,789 D629E probably damaging Het
Nlrp5 C T 7: 23,418,165 T438I probably benign Het
Olfr1238 T A 2: 89,407,070 Q3L probably benign Het
Olfr507 A G 7: 108,622,637 K275R probably damaging Het
Olfr610 A T 7: 103,506,610 I112N possibly damaging Het
Otud7a G T 7: 63,758,552 D868Y probably damaging Het
Pcdhga6 T C 18: 37,708,013 L262S probably damaging Het
Plec C T 15: 76,172,532 V4402I possibly damaging Het
Ppp1r14c A T 10: 3,423,510 D107V probably damaging Het
Prkg1 A T 19: 30,586,367 C482S probably damaging Het
Prpf40a A T 2: 53,156,841 N294K probably benign Het
Rbpj A G 5: 53,645,874 Y148C probably damaging Het
Rnf19a A G 15: 36,241,668 S742P possibly damaging Het
Rnf207 T A 4: 152,311,438 Q533L probably damaging Het
Rsf1 A G 7: 97,661,958 T632A Het
Rtl1 C T 12: 109,593,921 V495I possibly damaging Het
Sh2d3c T A 2: 32,749,376 C491* probably null Het
Sik1 A T 17: 31,850,046 L285Q probably benign Het
Sipa1l1 T A 12: 82,341,568 D189E probably benign Het
Slc25a25 G A 2: 32,451,165 Q54* probably null Het
Slu7 T C 11: 43,444,836 probably null Het
Sorbs3 T A 14: 70,193,916 N265I probably benign Het
Sspo A T 6: 48,463,310 E1645V probably benign Het
Swap70 A G 7: 110,221,875 D22G probably benign Het
Ttc34 T C 4: 154,861,300 C264R probably benign Het
Ttll2 T A 17: 7,352,091 T146S probably benign Het
Ttn C T 2: 76,927,204 E3402K unknown Het
Twf1 A T 15: 94,584,446 S140T probably benign Het
Vmn1r12 T C 6: 57,159,434 L172P probably damaging Het
Vmn1r19 T A 6: 57,404,679 N72K probably damaging Het
Vmn2r17 G A 5: 109,428,078 E272K probably benign Het
Zfpm2 A G 15: 41,102,612 D831G probably damaging Het
Other mutations in Iqgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Iqgap2 APN 13 95657944 splice site probably benign
IGL01968:Iqgap2 APN 13 95635582 missense possibly damaging 0.80
IGL02049:Iqgap2 APN 13 95675405 splice site probably benign
IGL02195:Iqgap2 APN 13 95661734 splice site probably benign
IGL02387:Iqgap2 APN 13 95689701 missense probably benign 0.00
IGL02634:Iqgap2 APN 13 95628114 missense probably damaging 1.00
IGL02666:Iqgap2 APN 13 95628056 missense probably damaging 1.00
IGL02685:Iqgap2 APN 13 95671404 missense probably damaging 1.00
IGL02927:Iqgap2 APN 13 95724676 missense possibly damaging 0.62
IGL02943:Iqgap2 APN 13 95661735 splice site probably benign
IGL03167:Iqgap2 APN 13 95684898 missense probably benign 0.34
IGL03169:Iqgap2 APN 13 95731277 splice site probably null
IGL03293:Iqgap2 APN 13 95731434 missense probably damaging 1.00
R0257:Iqgap2 UTSW 13 95724544 critical splice donor site probably null
R0335:Iqgap2 UTSW 13 95635633 missense probably damaging 0.99
R0360:Iqgap2 UTSW 13 95731275 splice site probably benign
R0364:Iqgap2 UTSW 13 95731275 splice site probably benign
R0419:Iqgap2 UTSW 13 95689699 critical splice donor site probably null
R1229:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1290:Iqgap2 UTSW 13 95668513 missense probably damaging 1.00
R1397:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1498:Iqgap2 UTSW 13 95646805 missense probably benign
R1513:Iqgap2 UTSW 13 95630010 missense probably damaging 1.00
R1630:Iqgap2 UTSW 13 95689785 missense probably benign
R2088:Iqgap2 UTSW 13 95891663 critical splice donor site probably null
R2928:Iqgap2 UTSW 13 95682236 missense probably benign
R3026:Iqgap2 UTSW 13 95673056 critical splice acceptor site probably null
R3720:Iqgap2 UTSW 13 95668528 splice site probably null
R3846:Iqgap2 UTSW 13 95673678 splice site probably benign
R4056:Iqgap2 UTSW 13 95750033 missense probably damaging 1.00
R4077:Iqgap2 UTSW 13 95657867 missense probably damaging 1.00
R4353:Iqgap2 UTSW 13 95671396 missense probably damaging 1.00
R4517:Iqgap2 UTSW 13 95664061 critical splice donor site probably null
R4628:Iqgap2 UTSW 13 95763329 missense probably benign 0.17
R4686:Iqgap2 UTSW 13 95721609 missense probably damaging 0.98
R4724:Iqgap2 UTSW 13 95635497 missense possibly damaging 0.73
R4826:Iqgap2 UTSW 13 95763275 missense probably damaging 1.00
R4847:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R4967:Iqgap2 UTSW 13 95630006 missense probably benign 0.00
R4973:Iqgap2 UTSW 13 95657797 splice site probably null
R5010:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R5086:Iqgap2 UTSW 13 95635580 missense probably benign 0.01
R5496:Iqgap2 UTSW 13 95630053 missense probably damaging 1.00
R5512:Iqgap2 UTSW 13 95675376 nonsense probably null
R5629:Iqgap2 UTSW 13 95632174 missense probably damaging 1.00
R5824:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5830:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5831:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5832:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5833:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5834:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5852:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5888:Iqgap2 UTSW 13 95635610 missense possibly damaging 0.89
R5889:Iqgap2 UTSW 13 95632042 missense probably benign 0.00
R6093:Iqgap2 UTSW 13 95628963 missense probably damaging 0.99
R6141:Iqgap2 UTSW 13 95721686 splice site probably null
R6404:Iqgap2 UTSW 13 95729477 missense probably benign 0.28
R6434:Iqgap2 UTSW 13 95682933 missense possibly damaging 0.85
R6648:Iqgap2 UTSW 13 95682211 missense probably benign 0.27
R6658:Iqgap2 UTSW 13 95660332 missense probably damaging 1.00
R6903:Iqgap2 UTSW 13 95661057 missense probably damaging 1.00
R7223:Iqgap2 UTSW 13 95628972 missense probably damaging 1.00
R7327:Iqgap2 UTSW 13 95635655 missense probably benign 0.00
R7371:Iqgap2 UTSW 13 95700338 splice site probably null
R7378:Iqgap2 UTSW 13 95732890 critical splice donor site probably null
R7441:Iqgap2 UTSW 13 95628076 missense probably benign 0.23
R7575:Iqgap2 UTSW 13 95661623 missense probably damaging 0.99
R7671:Iqgap2 UTSW 13 95628119 missense probably damaging 0.98
R7713:Iqgap2 UTSW 13 95731444 missense probably benign 0.01
R7806:Iqgap2 UTSW 13 95682257 missense probably benign 0.00
R8052:Iqgap2 UTSW 13 95657879 missense probably damaging 0.96
R8121:Iqgap2 UTSW 13 95724568 missense probably benign 0.00
R8261:Iqgap2 UTSW 13 95635570 missense probably damaging 1.00
R8301:Iqgap2 UTSW 13 95682151 critical splice donor site probably null
R8369:Iqgap2 UTSW 13 95661603 missense probably damaging 1.00
R8485:Iqgap2 UTSW 13 95660151 missense probably damaging 0.99
R8709:Iqgap2 UTSW 13 95660205 missense probably damaging 0.99
R8710:Iqgap2 UTSW 13 95660248 missense probably benign 0.24
R8737:Iqgap2 UTSW 13 95665750 missense probably damaging 1.00
X0066:Iqgap2 UTSW 13 95671383 missense probably damaging 0.98
Z1176:Iqgap2 UTSW 13 95731443 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CGATAACACCTGGTTACTGGG -3'
(R):5'- ACCTAGTGCTTGCTGAATAAGAAG -3'

Sequencing Primer
(F):5'- CAGGGCAACTAGCTAGTGAC -3'
(R):5'- GTAGGAGGTGATGATAAAATGACTCC -3'
Posted On2019-12-20