Mutagenetix > Incidental Mutation

Incidental Mutation 'R7893:Zfpm2'

609466

Institutional Source

Beutler Lab

Gene Symbol

Zfpm2

Ensembl Gene

ENSMUSG00000022306

Gene Name

zinc finger protein, multitype 2

Synonyms

B330005D23Rik, FOG2, FOG-2

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7893 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

40655035-41104592 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 41102612 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 831 (D831G)

Ref Sequence

ENSEMBL: ENSMUSP00000051335 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053467] [ENSMUST00000230319]

AlphaFold

Q8CCH7

Predicted Effect

probably damaging
Transcript: ENSMUST00000053467
AA Change: D831G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306
AA Change: D831G

Domain	Start	End	E-Value	Type
low complexity region	19	35	N/A	INTRINSIC
ZnF_C2H2	250	270	4.27e1	SMART
ZnF_C2H2	296	320	1.25e-1	SMART
ZnF_C2H2	335	357	4.05e-1	SMART
ZnF_C2H2	363	385	6.23e-2	SMART
ZnF_C2H2	548	569	1.43e1	SMART
ZnF_C2H2	687	714	1.06e2	SMART
low complexity region	731	741	N/A	INTRINSIC
ZnF_C2H2	854	874	5.4e1	SMART
ZnF_C2H2	1119	1145	4.99e1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000230319
AA Change: D699G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.1956

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

99% (70/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	T	C	4: 42,971,539	W291R	probably damaging	Het
9130019O22Rik	T	A	7: 127,386,544		probably benign	Het
Abca3	A	T	17: 24,385,466	I604F	probably damaging	Het
Adar	T	A	3: 89,750,651	D1062E	probably damaging	Het
Agap2	A	G	10: 127,080,195	T192A	unknown	Het
Aim2	T	C	1: 173,463,926	V299A	possibly damaging	Het
Arhgap33	T	C	7: 30,528,776	I394V	probably benign	Het
Atg2a	T	C	19: 6,251,296	F800S	probably damaging	Het
Btnl10	T	A	11: 58,923,809	N438K	probably benign	Het
C9	T	A	15: 6,483,245	F283I	possibly damaging	Het
Camk2n2	T	C	16: 20,621,076	N40S	possibly damaging	Het
Cd53	T	A	3: 106,767,386	I122F	probably benign	Het
Col4a1	T	C	8: 11,220,243	D45G	unknown	Het
Copa	T	A	1: 172,119,565	C1085*	probably null	Het
Cpt1b	A	G	15: 89,423,654		probably null	Het
Cyp24a1	C	G	2: 170,496,516		probably null	Het
Cyp2c40	A	T	19: 39,786,848	V320E	probably damaging	Het
Efcab7	A	T	4: 99,888,861	D210V	probably damaging	Het
Elfn2	G	A	15: 78,673,168	T393I	probably damaging	Het
Fbxw11	A	T	11: 32,720,489	I152L	probably benign	Het
Gab1	A	T	8: 80,784,766	F483L	possibly damaging	Het
Git2	G	T	5: 114,769,676	R43S	possibly damaging	Het
Gm11639	A	C	11: 104,979,360	S3985R	unknown	Het
Gm43302	G	A	5: 105,289,025	Q72*	probably null	Het
Hcn2	T	C	10: 79,724,411	L192P	probably damaging	Het
Htra4	A	C	8: 25,033,679	F290C	possibly damaging	Het
Ide	C	T	19: 37,284,151	V731I		Het
Igsf9	T	C	1: 172,497,302	L929P	probably damaging	Het
Iqgap2	G	A	13: 95,689,709	A535V	probably damaging	Het
Itga10	T	C	3: 96,649,612	W217R	probably damaging	Het
Kdm2b	A	G	5: 122,947,739	F276L	probably benign	Het
Klf16	T	C	10: 80,576,960	S81G	probably benign	Het
L1td1	G	T	4: 98,733,741	C180F	possibly damaging	Het
Map4k2	A	C	19: 6,353,511	H817P	probably damaging	Het
Marf1	A	T	16: 14,146,735	V446D	probably damaging	Het
Mfsd4b1	A	G	10: 40,007,317	S46P	probably benign	Het
Mylk	G	C	16: 34,879,524	S419T	probably benign	Het
Nckipsd	A	G	9: 108,815,389	H604R	probably damaging	Het
Nedd9	A	T	13: 41,315,789	D629E	probably damaging	Het
Nlrp5	C	T	7: 23,418,165	T438I	probably benign	Het
Olfr1238	T	A	2: 89,407,070	Q3L	probably benign	Het
Olfr507	A	G	7: 108,622,637	K275R	probably damaging	Het
Olfr610	A	T	7: 103,506,610	I112N	possibly damaging	Het
Otud7a	G	T	7: 63,758,552	D868Y	probably damaging	Het
Pcdhga6	T	C	18: 37,708,013	L262S	probably damaging	Het
Plec	C	T	15: 76,172,532	V4402I	possibly damaging	Het
Ppp1r14c	A	T	10: 3,423,510	D107V	probably damaging	Het
Prkg1	A	T	19: 30,586,367	C482S	probably damaging	Het
Prpf40a	A	T	2: 53,156,841	N294K	probably benign	Het
Rbpj	A	G	5: 53,645,874	Y148C	probably damaging	Het
Rnf19a	A	G	15: 36,241,668	S742P	possibly damaging	Het
Rnf207	T	A	4: 152,311,438	Q533L	probably damaging	Het
Rsf1	A	G	7: 97,661,958	T632A		Het
Rtl1	C	T	12: 109,593,921	V495I	possibly damaging	Het
Sh2d3c	T	A	2: 32,749,376	C491*	probably null	Het
Sik1	A	T	17: 31,850,046	L285Q	probably benign	Het
Sipa1l1	T	A	12: 82,341,568	D189E	probably benign	Het
Slc25a25	G	A	2: 32,451,165	Q54*	probably null	Het
Slu7	T	C	11: 43,444,836		probably null	Het
Sorbs3	T	A	14: 70,193,916	N265I	probably benign	Het
Sspo	A	T	6: 48,463,310	E1645V	probably benign	Het
Swap70	A	G	7: 110,221,875	D22G	probably benign	Het
Ttc34	T	C	4: 154,861,300	C264R	probably benign	Het
Ttll2	T	A	17: 7,352,091	T146S	probably benign	Het
Ttn	C	T	2: 76,927,204	E3402K	unknown	Het
Twf1	A	T	15: 94,584,446	S140T	probably benign	Het
Vmn1r12	T	C	6: 57,159,434	L172P	probably damaging	Het
Vmn1r19	T	A	6: 57,404,679	N72K	probably damaging	Het
Vmn2r17	G	A	5: 109,428,078	E272K	probably benign	Het

Other mutations in Zfpm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00473:Zfpm2	APN	15	41099287	missense	probably damaging	1.00
IGL00815:Zfpm2	APN	15	41099491	missense	probably benign	0.37
IGL00821:Zfpm2	APN	15	41103387	missense	probably damaging	1.00
IGL01622:Zfpm2	APN	15	41101924	missense	probably benign	0.07
IGL01623:Zfpm2	APN	15	41101924	missense	probably benign	0.07
IGL01807:Zfpm2	APN	15	40753056	critical splice donor site	probably null
IGL01872:Zfpm2	APN	15	41102387	missense	probably benign
IGL02087:Zfpm2	APN	15	41103121	missense	probably damaging	0.97
IGL02123:Zfpm2	APN	15	41102195	missense	probably damaging	1.00
IGL02355:Zfpm2	APN	15	41099494	missense	probably damaging	1.00
IGL02362:Zfpm2	APN	15	41099494	missense	probably damaging	1.00
IGL02579:Zfpm2	APN	15	41099472	missense	possibly damaging	0.91
IGL02752:Zfpm2	APN	15	41102019	missense	probably benign	0.23
IGL02792:Zfpm2	APN	15	41103013	missense	probably benign	0.00
IGL02861:Zfpm2	APN	15	41103266	missense	probably damaging	0.98
IGL03180:Zfpm2	APN	15	41101394	missense	probably damaging	1.00
IGL03344:Zfpm2	APN	15	41102774	missense	probably benign
R0305:Zfpm2	UTSW	15	40774035	splice site	probably benign
R0365:Zfpm2	UTSW	15	40774066	missense	possibly damaging	0.88
R1171:Zfpm2	UTSW	15	41101679	missense	probably damaging	1.00
R1456:Zfpm2	UTSW	15	41102481	missense	probably damaging	1.00
R1482:Zfpm2	UTSW	15	41099291	missense	probably damaging	1.00
R1580:Zfpm2	UTSW	15	41103209	missense	possibly damaging	0.84
R2119:Zfpm2	UTSW	15	41103023	missense	probably damaging	1.00
R2189:Zfpm2	UTSW	15	41101183	missense	possibly damaging	0.76
R2867:Zfpm2	UTSW	15	41099389	missense	probably benign	0.06
R2867:Zfpm2	UTSW	15	41099389	missense	probably benign	0.06
R2886:Zfpm2	UTSW	15	41102323	missense	probably benign	0.44
R3024:Zfpm2	UTSW	15	41102959	missense	probably benign	0.00
R4043:Zfpm2	UTSW	15	40870627	missense	possibly damaging	0.94
R4178:Zfpm2	UTSW	15	41103544	missense	probably damaging	1.00
R4465:Zfpm2	UTSW	15	41096161	missense	probably benign	0.00
R5263:Zfpm2	UTSW	15	41099395	missense	probably benign	0.45
R5266:Zfpm2	UTSW	15	41099469	missense	probably benign	0.01
R5352:Zfpm2	UTSW	15	40870542	missense	probably benign	0.01
R5584:Zfpm2	UTSW	15	41102537	missense	probably benign	0.45
R5661:Zfpm2	UTSW	15	41096071	nonsense	probably null
R6437:Zfpm2	UTSW	15	41099397	missense	probably benign
R6660:Zfpm2	UTSW	15	40655585	critical splice donor site	probably null
R6742:Zfpm2	UTSW	15	41101718	missense	probably benign
R6749:Zfpm2	UTSW	15	40954708	missense	possibly damaging	0.90
R7363:Zfpm2	UTSW	15	40753017	missense	probably damaging	1.00
R7401:Zfpm2	UTSW	15	41102990	missense	possibly damaging	0.87
R7657:Zfpm2	UTSW	15	41103275	missense	possibly damaging	0.78
R7690:Zfpm2	UTSW	15	40954766	missense	possibly damaging	0.45
R7698:Zfpm2	UTSW	15	41096091	missense	probably benign	0.03
R8081:Zfpm2	UTSW	15	41102248	missense	probably damaging	1.00
R8223:Zfpm2	UTSW	15	40752959	missense	probably benign	0.34
R9028:Zfpm2	UTSW	15	41103362	missense	possibly damaging	0.87
R9065:Zfpm2	UTSW	15	41099316	missense	possibly damaging	0.95
R9234:Zfpm2	UTSW	15	41103074	missense	probably damaging	1.00
R9474:Zfpm2	UTSW	15	41103471	missense	probably damaging	1.00
R9694:Zfpm2	UTSW	15	41102314	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- CTGGTCCAGCAGAGATTTCTTG -3'
(R):5'- CCAGGTCATTACGCTGATGTGC -3'

Sequencing Primer
(F):5'- CCAGCAGAGATTTCTTGATGTAGCC -3'
(R):5'- CTGATGTGCAGTGACAGGGC -3'

Posted On

2019-12-20