Incidental Mutation 'R7893:Zfpm2'
ID 609466
Institutional Source Beutler Lab
Gene Symbol Zfpm2
Ensembl Gene ENSMUSG00000022306
Gene Name zinc finger protein, multitype 2
Synonyms FOG2, B330005D23Rik, FOG-2
MMRRC Submission 045945-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7893 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 40518438-40967988 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 40966008 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 831 (D831G)
Ref Sequence ENSEMBL: ENSMUSP00000051335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053467] [ENSMUST00000230319]
AlphaFold Q8CCH7
Predicted Effect probably damaging
Transcript: ENSMUST00000053467
AA Change: D831G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306
AA Change: D831G

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
ZnF_C2H2 250 270 4.27e1 SMART
ZnF_C2H2 296 320 1.25e-1 SMART
ZnF_C2H2 335 357 4.05e-1 SMART
ZnF_C2H2 363 385 6.23e-2 SMART
ZnF_C2H2 548 569 1.43e1 SMART
ZnF_C2H2 687 714 1.06e2 SMART
low complexity region 731 741 N/A INTRINSIC
ZnF_C2H2 854 874 5.4e1 SMART
ZnF_C2H2 1119 1145 4.99e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000230319
AA Change: D699G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1956 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,604,440 (GRCm39) I604F probably damaging Het
Adar T A 3: 89,657,958 (GRCm39) D1062E probably damaging Het
Agap2 A G 10: 126,916,064 (GRCm39) T192A unknown Het
Aim2 T C 1: 173,291,492 (GRCm39) V299A possibly damaging Het
Arhgap33 T C 7: 30,228,201 (GRCm39) I394V probably benign Het
Atg2a T C 19: 6,301,326 (GRCm39) F800S probably damaging Het
Btnl10 T A 11: 58,814,635 (GRCm39) N438K probably benign Het
C9 T A 15: 6,512,726 (GRCm39) F283I possibly damaging Het
Camk2n2 T C 16: 20,439,826 (GRCm39) N40S possibly damaging Het
Cd53 T A 3: 106,674,702 (GRCm39) I122F probably benign Het
Col4a1 T C 8: 11,270,243 (GRCm39) D45G unknown Het
Copa T A 1: 171,947,132 (GRCm39) C1085* probably null Het
Cpt1b A G 15: 89,307,857 (GRCm39) probably null Het
Cyp24a1 C G 2: 170,338,436 (GRCm39) probably null Het
Cyp2c40 A T 19: 39,775,292 (GRCm39) V320E probably damaging Het
Efcab3 A C 11: 104,870,186 (GRCm39) S3985R unknown Het
Efcab7 A T 4: 99,746,058 (GRCm39) D210V probably damaging Het
Elfn2 G A 15: 78,557,368 (GRCm39) T393I probably damaging Het
Fbxw11 A T 11: 32,670,489 (GRCm39) I152L probably benign Het
Gab1 A T 8: 81,511,395 (GRCm39) F483L possibly damaging Het
Git2 G T 5: 114,907,737 (GRCm39) R43S possibly damaging Het
Gm43302 G A 5: 105,436,891 (GRCm39) Q72* probably null Het
Hcn2 T C 10: 79,560,245 (GRCm39) L192P probably damaging Het
Htra4 A C 8: 25,523,695 (GRCm39) F290C possibly damaging Het
Ide C T 19: 37,261,550 (GRCm39) V731I Het
Igsf9 T C 1: 172,324,869 (GRCm39) L929P probably damaging Het
Iqgap2 G A 13: 95,826,217 (GRCm39) A535V probably damaging Het
Itga10 T C 3: 96,556,928 (GRCm39) W217R probably damaging Het
Kdm2b A G 5: 123,085,802 (GRCm39) F276L probably benign Het
Klf16 T C 10: 80,412,794 (GRCm39) S81G probably benign Het
L1td1 G T 4: 98,621,978 (GRCm39) C180F possibly damaging Het
Map4k2 A C 19: 6,403,541 (GRCm39) H817P probably damaging Het
Marf1 A T 16: 13,964,599 (GRCm39) V446D probably damaging Het
Mfsd4b1 A G 10: 39,883,313 (GRCm39) S46P probably benign Het
Mylk G C 16: 34,699,894 (GRCm39) S419T probably benign Het
Nckipsd A G 9: 108,692,588 (GRCm39) H604R probably damaging Het
Nedd9 A T 13: 41,469,265 (GRCm39) D629E probably damaging Het
Nlrp5 C T 7: 23,117,590 (GRCm39) T438I probably benign Het
Or4a39 T A 2: 89,237,414 (GRCm39) Q3L probably benign Het
Or51ag1 A T 7: 103,155,817 (GRCm39) I112N possibly damaging Het
Or5p79 A G 7: 108,221,844 (GRCm39) K275R probably damaging Het
Otud7a G T 7: 63,408,300 (GRCm39) D868Y probably damaging Het
Pcdhga6 T C 18: 37,841,066 (GRCm39) L262S probably damaging Het
Plec C T 15: 76,056,732 (GRCm39) V4402I possibly damaging Het
Ppp1r14c A T 10: 3,373,510 (GRCm39) D107V probably damaging Het
Prkg1 A T 19: 30,563,767 (GRCm39) C482S probably damaging Het
Prpf40a A T 2: 53,046,853 (GRCm39) N294K probably benign Het
Rbpj A G 5: 53,803,216 (GRCm39) Y148C probably damaging Het
Rnf19a A G 15: 36,241,814 (GRCm39) S742P possibly damaging Het
Rnf207 T A 4: 152,395,895 (GRCm39) Q533L probably damaging Het
Rsf1 A G 7: 97,311,165 (GRCm39) T632A Het
Rtl1 C T 12: 109,560,355 (GRCm39) V495I possibly damaging Het
Sh2d3c T A 2: 32,639,388 (GRCm39) C491* probably null Het
Sik1 A T 17: 32,069,020 (GRCm39) L285Q probably benign Het
Sipa1l1 T A 12: 82,388,342 (GRCm39) D189E probably benign Het
Slc25a25 G A 2: 32,341,177 (GRCm39) Q54* probably null Het
Slu7 T C 11: 43,335,663 (GRCm39) probably null Het
Sorbs3 T A 14: 70,431,365 (GRCm39) N265I probably benign Het
Spata31g1 T C 4: 42,971,539 (GRCm39) W291R probably damaging Het
Sspo A T 6: 48,440,244 (GRCm39) E1645V probably benign Het
Swap70 A G 7: 109,821,082 (GRCm39) D22G probably benign Het
Ttc34 T C 4: 154,945,757 (GRCm39) C264R probably benign Het
Ttll2 T A 17: 7,619,490 (GRCm39) T146S probably benign Het
Ttn C T 2: 76,757,548 (GRCm39) E3402K unknown Het
Twf1 A T 15: 94,482,327 (GRCm39) S140T probably benign Het
Vmn1r12 T C 6: 57,136,419 (GRCm39) L172P probably damaging Het
Vmn1r19 T A 6: 57,381,664 (GRCm39) N72K probably damaging Het
Vmn2r17 G A 5: 109,575,944 (GRCm39) E272K probably benign Het
Zfp747l1 T A 7: 126,985,716 (GRCm39) probably benign Het
Other mutations in Zfpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Zfpm2 APN 15 40,962,683 (GRCm39) missense probably damaging 1.00
IGL00815:Zfpm2 APN 15 40,962,887 (GRCm39) missense probably benign 0.37
IGL00821:Zfpm2 APN 15 40,966,783 (GRCm39) missense probably damaging 1.00
IGL01622:Zfpm2 APN 15 40,965,320 (GRCm39) missense probably benign 0.07
IGL01623:Zfpm2 APN 15 40,965,320 (GRCm39) missense probably benign 0.07
IGL01807:Zfpm2 APN 15 40,616,452 (GRCm39) critical splice donor site probably null
IGL01872:Zfpm2 APN 15 40,965,783 (GRCm39) missense probably benign
IGL02087:Zfpm2 APN 15 40,966,517 (GRCm39) missense probably damaging 0.97
IGL02123:Zfpm2 APN 15 40,965,591 (GRCm39) missense probably damaging 1.00
IGL02355:Zfpm2 APN 15 40,962,890 (GRCm39) missense probably damaging 1.00
IGL02362:Zfpm2 APN 15 40,962,890 (GRCm39) missense probably damaging 1.00
IGL02579:Zfpm2 APN 15 40,962,868 (GRCm39) missense possibly damaging 0.91
IGL02752:Zfpm2 APN 15 40,965,415 (GRCm39) missense probably benign 0.23
IGL02792:Zfpm2 APN 15 40,966,409 (GRCm39) missense probably benign 0.00
IGL02861:Zfpm2 APN 15 40,966,662 (GRCm39) missense probably damaging 0.98
IGL03180:Zfpm2 APN 15 40,964,790 (GRCm39) missense probably damaging 1.00
IGL03344:Zfpm2 APN 15 40,966,170 (GRCm39) missense probably benign
R0305:Zfpm2 UTSW 15 40,637,431 (GRCm39) splice site probably benign
R0365:Zfpm2 UTSW 15 40,637,462 (GRCm39) missense possibly damaging 0.88
R1171:Zfpm2 UTSW 15 40,965,075 (GRCm39) missense probably damaging 1.00
R1456:Zfpm2 UTSW 15 40,965,877 (GRCm39) missense probably damaging 1.00
R1482:Zfpm2 UTSW 15 40,962,687 (GRCm39) missense probably damaging 1.00
R1580:Zfpm2 UTSW 15 40,966,605 (GRCm39) missense possibly damaging 0.84
R2119:Zfpm2 UTSW 15 40,966,419 (GRCm39) missense probably damaging 1.00
R2189:Zfpm2 UTSW 15 40,964,579 (GRCm39) missense possibly damaging 0.76
R2867:Zfpm2 UTSW 15 40,962,785 (GRCm39) missense probably benign 0.06
R2867:Zfpm2 UTSW 15 40,962,785 (GRCm39) missense probably benign 0.06
R2886:Zfpm2 UTSW 15 40,965,719 (GRCm39) missense probably benign 0.44
R3024:Zfpm2 UTSW 15 40,966,355 (GRCm39) missense probably benign 0.00
R4043:Zfpm2 UTSW 15 40,734,023 (GRCm39) missense possibly damaging 0.94
R4178:Zfpm2 UTSW 15 40,966,940 (GRCm39) missense probably damaging 1.00
R4465:Zfpm2 UTSW 15 40,959,557 (GRCm39) missense probably benign 0.00
R5263:Zfpm2 UTSW 15 40,962,791 (GRCm39) missense probably benign 0.45
R5266:Zfpm2 UTSW 15 40,962,865 (GRCm39) missense probably benign 0.01
R5352:Zfpm2 UTSW 15 40,733,938 (GRCm39) missense probably benign 0.01
R5584:Zfpm2 UTSW 15 40,965,933 (GRCm39) missense probably benign 0.45
R5661:Zfpm2 UTSW 15 40,959,467 (GRCm39) nonsense probably null
R6437:Zfpm2 UTSW 15 40,962,793 (GRCm39) missense probably benign
R6660:Zfpm2 UTSW 15 40,518,981 (GRCm39) critical splice donor site probably null
R6742:Zfpm2 UTSW 15 40,965,114 (GRCm39) missense probably benign
R6749:Zfpm2 UTSW 15 40,818,104 (GRCm39) missense possibly damaging 0.90
R7363:Zfpm2 UTSW 15 40,616,413 (GRCm39) missense probably damaging 1.00
R7401:Zfpm2 UTSW 15 40,966,386 (GRCm39) missense possibly damaging 0.87
R7657:Zfpm2 UTSW 15 40,966,671 (GRCm39) missense possibly damaging 0.78
R7690:Zfpm2 UTSW 15 40,818,162 (GRCm39) missense possibly damaging 0.45
R7698:Zfpm2 UTSW 15 40,959,487 (GRCm39) missense probably benign 0.03
R8081:Zfpm2 UTSW 15 40,965,644 (GRCm39) missense probably damaging 1.00
R8223:Zfpm2 UTSW 15 40,616,355 (GRCm39) missense probably benign 0.34
R9028:Zfpm2 UTSW 15 40,966,758 (GRCm39) missense possibly damaging 0.87
R9065:Zfpm2 UTSW 15 40,962,712 (GRCm39) missense possibly damaging 0.95
R9234:Zfpm2 UTSW 15 40,966,470 (GRCm39) missense probably damaging 1.00
R9474:Zfpm2 UTSW 15 40,966,867 (GRCm39) missense probably damaging 1.00
R9694:Zfpm2 UTSW 15 40,965,710 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CTGGTCCAGCAGAGATTTCTTG -3'
(R):5'- CCAGGTCATTACGCTGATGTGC -3'

Sequencing Primer
(F):5'- CCAGCAGAGATTTCTTGATGTAGCC -3'
(R):5'- CTGATGTGCAGTGACAGGGC -3'
Posted On 2019-12-20