Mutagenetix > Incidental Mutation

Incidental Mutation 'R7893:Mylk'

609473

Institutional Source

Beutler Lab

Gene Symbol

Mylk

Ensembl Gene

ENSMUSG00000022836

Gene Name

myosin, light polypeptide kinase

Synonyms

Mlck, nmMlck, telokin, A930019C19Rik, 9530072E15Rik, MLCK108, MLCK210

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7893 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34745210-35002420 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 34879524 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 419 (S419T)

Ref Sequence

ENSEMBL: ENSMUSP00000023538 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023538]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000023538
AA Change: S419T

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: S419T

Domain	Start	End	E-Value	Type
IGc2	54	122	9.05e-11	SMART
IGc2	177	244	3.94e-11	SMART
Pfam:23ISL	255	409	3.6e-60	PFAM
IGc2	423	491	1.55e-9	SMART
IGc2	523	587	3.32e-18	SMART
IGc2	632	699	6.02e-7	SMART
IGc2	730	798	1.36e-5	SMART
low complexity region	827	844	N/A	INTRINSIC
IGc2	1141	1208	2.42e-11	SMART
low complexity region	1251	1269	N/A	INTRINSIC
IG	1275	1359	4.56e-7	SMART
FN3	1362	1444	2.33e-11	SMART
low complexity region	1457	1479	N/A	INTRINSIC
S_TKc	1495	1750	4.23e-95	SMART
IGc2	1852	1920	5.92e-15	SMART
low complexity region	1934	1950	N/A	INTRINSIC

Meta Mutation Damage Score

0.0979

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

99% (70/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	T	C	4: 42,971,539	W291R	probably damaging	Het
9130019O22Rik	T	A	7: 127,386,544		probably benign	Het
Abca3	A	T	17: 24,385,466	I604F	probably damaging	Het
Adar	T	A	3: 89,750,651	D1062E	probably damaging	Het
Agap2	A	G	10: 127,080,195	T192A	unknown	Het
Aim2	T	C	1: 173,463,926	V299A	possibly damaging	Het
Arhgap33	T	C	7: 30,528,776	I394V	probably benign	Het
Atg2a	T	C	19: 6,251,296	F800S	probably damaging	Het
Btnl10	T	A	11: 58,923,809	N438K	probably benign	Het
C9	T	A	15: 6,483,245	F283I	possibly damaging	Het
Camk2n2	T	C	16: 20,621,076	N40S	possibly damaging	Het
Cd53	T	A	3: 106,767,386	I122F	probably benign	Het
Col4a1	T	C	8: 11,220,243	D45G	unknown	Het
Copa	T	A	1: 172,119,565	C1085*	probably null	Het
Cpt1b	A	G	15: 89,423,654		probably null	Het
Cyp24a1	C	G	2: 170,496,516		probably null	Het
Cyp2c40	A	T	19: 39,786,848	V320E	probably damaging	Het
Efcab7	A	T	4: 99,888,861	D210V	probably damaging	Het
Elfn2	G	A	15: 78,673,168	T393I	probably damaging	Het
Fbxw11	A	T	11: 32,720,489	I152L	probably benign	Het
Gab1	A	T	8: 80,784,766	F483L	possibly damaging	Het
Git2	G	T	5: 114,769,676	R43S	possibly damaging	Het
Gm11639	A	C	11: 104,979,360	S3985R	unknown	Het
Gm43302	G	A	5: 105,289,025	Q72*	probably null	Het
Hcn2	T	C	10: 79,724,411	L192P	probably damaging	Het
Htra4	A	C	8: 25,033,679	F290C	possibly damaging	Het
Ide	C	T	19: 37,284,151	V731I		Het
Igsf9	T	C	1: 172,497,302	L929P	probably damaging	Het
Iqgap2	G	A	13: 95,689,709	A535V	probably damaging	Het
Itga10	T	C	3: 96,649,612	W217R	probably damaging	Het
Kdm2b	A	G	5: 122,947,739	F276L	probably benign	Het
Klf16	T	C	10: 80,576,960	S81G	probably benign	Het
L1td1	G	T	4: 98,733,741	C180F	possibly damaging	Het
Map4k2	A	C	19: 6,353,511	H817P	probably damaging	Het
Marf1	A	T	16: 14,146,735	V446D	probably damaging	Het
Mfsd4b1	A	G	10: 40,007,317	S46P	probably benign	Het
Nckipsd	A	G	9: 108,815,389	H604R	probably damaging	Het
Nedd9	A	T	13: 41,315,789	D629E	probably damaging	Het
Nlrp5	C	T	7: 23,418,165	T438I	probably benign	Het
Olfr1238	T	A	2: 89,407,070	Q3L	probably benign	Het
Olfr507	A	G	7: 108,622,637	K275R	probably damaging	Het
Olfr610	A	T	7: 103,506,610	I112N	possibly damaging	Het
Otud7a	G	T	7: 63,758,552	D868Y	probably damaging	Het
Pcdhga6	T	C	18: 37,708,013	L262S	probably damaging	Het
Plec	C	T	15: 76,172,532	V4402I	possibly damaging	Het
Ppp1r14c	A	T	10: 3,423,510	D107V	probably damaging	Het
Prkg1	A	T	19: 30,586,367	C482S	probably damaging	Het
Prpf40a	A	T	2: 53,156,841	N294K	probably benign	Het
Rbpj	A	G	5: 53,645,874	Y148C	probably damaging	Het
Rnf19a	A	G	15: 36,241,668	S742P	possibly damaging	Het
Rnf207	T	A	4: 152,311,438	Q533L	probably damaging	Het
Rsf1	A	G	7: 97,661,958	T632A		Het
Rtl1	C	T	12: 109,593,921	V495I	possibly damaging	Het
Sh2d3c	T	A	2: 32,749,376	C491*	probably null	Het
Sik1	A	T	17: 31,850,046	L285Q	probably benign	Het
Sipa1l1	T	A	12: 82,341,568	D189E	probably benign	Het
Slc25a25	G	A	2: 32,451,165	Q54*	probably null	Het
Slu7	T	C	11: 43,444,836		probably null	Het
Sorbs3	T	A	14: 70,193,916	N265I	probably benign	Het
Sspo	A	T	6: 48,463,310	E1645V	probably benign	Het
Swap70	A	G	7: 110,221,875	D22G	probably benign	Het
Ttc34	T	C	4: 154,861,300	C264R	probably benign	Het
Ttll2	T	A	17: 7,352,091	T146S	probably benign	Het
Ttn	C	T	2: 76,927,204	E3402K	unknown	Het
Twf1	A	T	15: 94,584,446	S140T	probably benign	Het
Vmn1r12	T	C	6: 57,159,434	L172P	probably damaging	Het
Vmn1r19	T	A	6: 57,404,679	N72K	probably damaging	Het
Vmn2r17	G	A	5: 109,428,078	E272K	probably benign	Het
Zfpm2	A	G	15: 41,102,612	D831G	probably damaging	Het

Other mutations in Mylk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01384:Mylk	APN	16	34938952	missense	probably benign	0.36
IGL01386:Mylk	APN	16	34971240	critical splice acceptor site	probably null
IGL01684:Mylk	APN	16	34971940	missense	possibly damaging	0.55
IGL01884:Mylk	APN	16	34988877	splice site	probably benign
IGL02079:Mylk	APN	16	34860631	missense	possibly damaging	0.87
IGL02104:Mylk	APN	16	34815435	missense	probably benign	0.06
IGL02624:Mylk	APN	16	34929896	missense	probably benign	0.29
IGL02756:Mylk	APN	16	34963646	missense	probably benign	0.42
IGL02794:Mylk	APN	16	34986541	missense	probably benign	0.21
IGL02833:Mylk	APN	16	34914900	missense	probably benign	0.01
IGL02946:Mylk	APN	16	34921788	missense	probably benign	0.10
IGL03012:Mylk	APN	16	34952781	missense	probably benign	0.03
IGL03093:Mylk	APN	16	34912192	missense	possibly damaging	0.62
IGL03272:Mylk	APN	16	34979189	missense	probably benign	0.09
billy	UTSW	16	34875620	missense	probably damaging	0.97
brutus	UTSW	16	34953695	missense	probably benign	0.12
Club	UTSW	16	34912275	nonsense	probably null
popeye	UTSW	16	34963577	missense	probably benign	0.29
F5770:Mylk	UTSW	16	34995204	critical splice donor site	probably null
P4717OSA:Mylk	UTSW	16	34977113	splice site	probably benign
PIT4382001:Mylk	UTSW	16	34875642	missense	probably damaging	0.99
R0131:Mylk	UTSW	16	34875504	missense	probably benign	0.03
R0309:Mylk	UTSW	16	34912297	splice site	probably benign
R0358:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0381:Mylk	UTSW	16	34784974	splice site	probably null
R0390:Mylk	UTSW	16	34875620	missense	probably damaging	0.97
R0413:Mylk	UTSW	16	34921944	missense	probably benign	0.01
R0536:Mylk	UTSW	16	35000387	missense	possibly damaging	0.95
R0544:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0545:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0546:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0547:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0548:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0627:Mylk	UTSW	16	35000429	missense	probably damaging	1.00
R0726:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0755:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0782:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0783:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0784:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R1136:Mylk	UTSW	16	35000318	missense	probably damaging	1.00
R1170:Mylk	UTSW	16	34874039	missense	probably benign	0.20
R1222:Mylk	UTSW	16	34860652	missense	probably benign	0.12
R1445:Mylk	UTSW	16	34815465	missense	possibly damaging	0.57
R1583:Mylk	UTSW	16	34875586	missense	probably benign	0.29
R1618:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R1643:Mylk	UTSW	16	34875635	missense	probably benign	0.03
R1702:Mylk	UTSW	16	34921944	missense	probably benign	0.00
R1776:Mylk	UTSW	16	34952782	missense	probably benign	0.16
R1865:Mylk	UTSW	16	34912230	missense	probably benign	0.03
R1975:Mylk	UTSW	16	34880303	splice site	probably null
R2016:Mylk	UTSW	16	34996817	missense	probably damaging	1.00
R2045:Mylk	UTSW	16	34953653	missense	probably benign	0.29
R2134:Mylk	UTSW	16	34986476	missense	probably benign	0.13
R3547:Mylk	UTSW	16	34880168	missense	possibly damaging	0.61
R3844:Mylk	UTSW	16	34921877	missense	probably benign	0.01
R4003:Mylk	UTSW	16	34963577	missense	probably benign	0.29
R4396:Mylk	UTSW	16	34912275	nonsense	probably null
R4470:Mylk	UTSW	16	34912152	missense	probably benign	0.09
R4507:Mylk	UTSW	16	34953695	missense	probably benign	0.12
R4700:Mylk	UTSW	16	34922435	missense	probably benign	0.16
R4751:Mylk	UTSW	16	34879169	missense	probably benign	0.29
R4815:Mylk	UTSW	16	34894925	missense	probably damaging	0.97
R4832:Mylk	UTSW	16	34922367	missense	probably benign	0.36
R4872:Mylk	UTSW	16	34914990	missense	possibly damaging	0.89
R4953:Mylk	UTSW	16	34988961	missense	probably damaging	1.00
R4969:Mylk	UTSW	16	34971440	missense	probably damaging	0.96
R5009:Mylk	UTSW	16	34899507	missense	probably benign	0.39
R5130:Mylk	UTSW	16	34988997	missense	probably damaging	1.00
R5173:Mylk	UTSW	16	34977013	missense	probably benign	0.40
R5195:Mylk	UTSW	16	34979215	missense	probably damaging	1.00
R5209:Mylk	UTSW	16	34922625	missense	possibly damaging	0.55
R5311:Mylk	UTSW	16	34921757	missense	probably benign	0.01
R5418:Mylk	UTSW	16	34912230	missense	probably benign	0.02
R5481:Mylk	UTSW	16	34921604	missense	probably benign	0.09
R5590:Mylk	UTSW	16	34879352	missense	probably benign	0.29
R5603:Mylk	UTSW	16	34956492	missense	probably benign	0.06
R5823:Mylk	UTSW	16	34894947	critical splice donor site	probably null
R6290:Mylk	UTSW	16	34894843	missense	probably benign	0.39
R6351:Mylk	UTSW	16	34921971	missense	probably benign	0.01
R6365:Mylk	UTSW	16	34860591	missense	probably benign	0.12
R6490:Mylk	UTSW	16	34929867	missense	possibly damaging	0.74
R6723:Mylk	UTSW	16	34929888	missense	possibly damaging	0.74
R6864:Mylk	UTSW	16	34874150	missense	probably benign	0.03
R6908:Mylk	UTSW	16	34880273	missense	probably benign	0.18
R6949:Mylk	UTSW	16	35000318	missense	probably damaging	1.00
R7018:Mylk	UTSW	16	35000426	missense	possibly damaging	0.88
R7035:Mylk	UTSW	16	34976982	missense	possibly damaging	0.89
R7162:Mylk	UTSW	16	34922529	missense	probably damaging	1.00
R7236:Mylk	UTSW	16	34922529	missense	probably damaging	1.00
R7269:Mylk	UTSW	16	34785011	missense	probably damaging	0.96
R7475:Mylk	UTSW	16	34914076	splice site	probably null
R7525:Mylk	UTSW	16	34988987	missense	probably benign	0.06
R7587:Mylk	UTSW	16	34922517	missense	probably benign	0.29
R7607:Mylk	UTSW	16	34894814	missense	probably benign	0.09
R7616:Mylk	UTSW	16	34879557	missense	probably damaging	0.97
R7647:Mylk	UTSW	16	34879524	missense	probably benign	0.29
R7648:Mylk	UTSW	16	34879524	missense	probably benign	0.29
R7764:Mylk	UTSW	16	34922183	missense	probably benign	0.16
R7890:Mylk	UTSW	16	34963648	nonsense	probably null
R7892:Mylk	UTSW	16	34879524	missense	probably benign	0.29
R8065:Mylk	UTSW	16	34972019	missense	probably benign	0.08
R8067:Mylk	UTSW	16	34972019	missense	probably benign	0.08
R8143:Mylk	UTSW	16	34914155	missense	possibly damaging	0.87
R8210:Mylk	UTSW	16	35000351	missense	probably damaging	1.00
R8271:Mylk	UTSW	16	34922579	missense	probably damaging	0.97
R8540:Mylk	UTSW	16	34929887	missense	possibly damaging	0.87
R8721:Mylk	UTSW	16	34996806	missense	probably damaging	1.00
R8743:Mylk	UTSW	16	34921057	missense	probably benign	0.03
R8798:Mylk	UTSW	16	34899402	missense	possibly damaging	0.89
R8956:Mylk	UTSW	16	34971409	missense	probably benign	0.01
R9131:Mylk	UTSW	16	34956465	missense	probably benign	0.29
R9403:Mylk	UTSW	16	34875642	nonsense	probably null
R9624:Mylk	UTSW	16	34879307	missense	probably benign	0.29
R9735:Mylk	UTSW	16	34914809	missense	probably benign	0.09
R9756:Mylk	UTSW	16	34914017	missense	probably damaging	0.96
R9763:Mylk	UTSW	16	34879112	nonsense	probably null
RF001:Mylk	UTSW	16	34879371	missense	probably benign	0.03
V7580:Mylk	UTSW	16	34995204	critical splice donor site	probably null
V7583:Mylk	UTSW	16	34995204	critical splice donor site	probably null
X0065:Mylk	UTSW	16	35000441	missense	probably damaging	1.00
Z1177:Mylk	UTSW	16	34922651	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- CTTGAAAGTCCAGCCAGAAGC -3'
(R):5'- AAGACCCTGGAAGGAAGCTTC -3'

Sequencing Primer
(F):5'- AGTACCAGCCATAGGGTCCTTC -3'
(R):5'- AAGCTTCCTGGAGGGCCTAG -3'

Posted On

2019-12-20