Incidental Mutation 'R7893:Mylk'
ID 609473
Institutional Source Beutler Lab
Gene Symbol Mylk
Ensembl Gene ENSMUSG00000022836
Gene Name myosin, light polypeptide kinase
Synonyms Mlck, telokin, nmMlck, 9530072E15Rik, A930019C19Rik, MLCK108, MLCK210
MMRRC Submission 045945-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7893 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 34565580-34822790 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 34699894 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 419 (S419T)
Ref Sequence ENSEMBL: ENSMUSP00000023538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023538]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000023538
AA Change: S419T

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: S419T

DomainStartEndE-ValueType
IGc2 54 122 9.05e-11 SMART
IGc2 177 244 3.94e-11 SMART
Pfam:23ISL 255 409 3.6e-60 PFAM
IGc2 423 491 1.55e-9 SMART
IGc2 523 587 3.32e-18 SMART
IGc2 632 699 6.02e-7 SMART
IGc2 730 798 1.36e-5 SMART
low complexity region 827 844 N/A INTRINSIC
IGc2 1141 1208 2.42e-11 SMART
low complexity region 1251 1269 N/A INTRINSIC
IG 1275 1359 4.56e-7 SMART
FN3 1362 1444 2.33e-11 SMART
low complexity region 1457 1479 N/A INTRINSIC
S_TKc 1495 1750 4.23e-95 SMART
IGc2 1852 1920 5.92e-15 SMART
low complexity region 1934 1950 N/A INTRINSIC
Meta Mutation Damage Score 0.0979 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,604,440 (GRCm39) I604F probably damaging Het
Adar T A 3: 89,657,958 (GRCm39) D1062E probably damaging Het
Agap2 A G 10: 126,916,064 (GRCm39) T192A unknown Het
Aim2 T C 1: 173,291,492 (GRCm39) V299A possibly damaging Het
Arhgap33 T C 7: 30,228,201 (GRCm39) I394V probably benign Het
Atg2a T C 19: 6,301,326 (GRCm39) F800S probably damaging Het
Btnl10 T A 11: 58,814,635 (GRCm39) N438K probably benign Het
C9 T A 15: 6,512,726 (GRCm39) F283I possibly damaging Het
Camk2n2 T C 16: 20,439,826 (GRCm39) N40S possibly damaging Het
Cd53 T A 3: 106,674,702 (GRCm39) I122F probably benign Het
Col4a1 T C 8: 11,270,243 (GRCm39) D45G unknown Het
Copa T A 1: 171,947,132 (GRCm39) C1085* probably null Het
Cpt1b A G 15: 89,307,857 (GRCm39) probably null Het
Cyp24a1 C G 2: 170,338,436 (GRCm39) probably null Het
Cyp2c40 A T 19: 39,775,292 (GRCm39) V320E probably damaging Het
Efcab3 A C 11: 104,870,186 (GRCm39) S3985R unknown Het
Efcab7 A T 4: 99,746,058 (GRCm39) D210V probably damaging Het
Elfn2 G A 15: 78,557,368 (GRCm39) T393I probably damaging Het
Fbxw11 A T 11: 32,670,489 (GRCm39) I152L probably benign Het
Gab1 A T 8: 81,511,395 (GRCm39) F483L possibly damaging Het
Git2 G T 5: 114,907,737 (GRCm39) R43S possibly damaging Het
Gm43302 G A 5: 105,436,891 (GRCm39) Q72* probably null Het
Hcn2 T C 10: 79,560,245 (GRCm39) L192P probably damaging Het
Htra4 A C 8: 25,523,695 (GRCm39) F290C possibly damaging Het
Ide C T 19: 37,261,550 (GRCm39) V731I Het
Igsf9 T C 1: 172,324,869 (GRCm39) L929P probably damaging Het
Iqgap2 G A 13: 95,826,217 (GRCm39) A535V probably damaging Het
Itga10 T C 3: 96,556,928 (GRCm39) W217R probably damaging Het
Kdm2b A G 5: 123,085,802 (GRCm39) F276L probably benign Het
Klf16 T C 10: 80,412,794 (GRCm39) S81G probably benign Het
L1td1 G T 4: 98,621,978 (GRCm39) C180F possibly damaging Het
Map4k2 A C 19: 6,403,541 (GRCm39) H817P probably damaging Het
Marf1 A T 16: 13,964,599 (GRCm39) V446D probably damaging Het
Mfsd4b1 A G 10: 39,883,313 (GRCm39) S46P probably benign Het
Nckipsd A G 9: 108,692,588 (GRCm39) H604R probably damaging Het
Nedd9 A T 13: 41,469,265 (GRCm39) D629E probably damaging Het
Nlrp5 C T 7: 23,117,590 (GRCm39) T438I probably benign Het
Or4a39 T A 2: 89,237,414 (GRCm39) Q3L probably benign Het
Or51ag1 A T 7: 103,155,817 (GRCm39) I112N possibly damaging Het
Or5p79 A G 7: 108,221,844 (GRCm39) K275R probably damaging Het
Otud7a G T 7: 63,408,300 (GRCm39) D868Y probably damaging Het
Pcdhga6 T C 18: 37,841,066 (GRCm39) L262S probably damaging Het
Plec C T 15: 76,056,732 (GRCm39) V4402I possibly damaging Het
Ppp1r14c A T 10: 3,373,510 (GRCm39) D107V probably damaging Het
Prkg1 A T 19: 30,563,767 (GRCm39) C482S probably damaging Het
Prpf40a A T 2: 53,046,853 (GRCm39) N294K probably benign Het
Rbpj A G 5: 53,803,216 (GRCm39) Y148C probably damaging Het
Rnf19a A G 15: 36,241,814 (GRCm39) S742P possibly damaging Het
Rnf207 T A 4: 152,395,895 (GRCm39) Q533L probably damaging Het
Rsf1 A G 7: 97,311,165 (GRCm39) T632A Het
Rtl1 C T 12: 109,560,355 (GRCm39) V495I possibly damaging Het
Sh2d3c T A 2: 32,639,388 (GRCm39) C491* probably null Het
Sik1 A T 17: 32,069,020 (GRCm39) L285Q probably benign Het
Sipa1l1 T A 12: 82,388,342 (GRCm39) D189E probably benign Het
Slc25a25 G A 2: 32,341,177 (GRCm39) Q54* probably null Het
Slu7 T C 11: 43,335,663 (GRCm39) probably null Het
Sorbs3 T A 14: 70,431,365 (GRCm39) N265I probably benign Het
Spata31g1 T C 4: 42,971,539 (GRCm39) W291R probably damaging Het
Sspo A T 6: 48,440,244 (GRCm39) E1645V probably benign Het
Swap70 A G 7: 109,821,082 (GRCm39) D22G probably benign Het
Ttc34 T C 4: 154,945,757 (GRCm39) C264R probably benign Het
Ttll2 T A 17: 7,619,490 (GRCm39) T146S probably benign Het
Ttn C T 2: 76,757,548 (GRCm39) E3402K unknown Het
Twf1 A T 15: 94,482,327 (GRCm39) S140T probably benign Het
Vmn1r12 T C 6: 57,136,419 (GRCm39) L172P probably damaging Het
Vmn1r19 T A 6: 57,381,664 (GRCm39) N72K probably damaging Het
Vmn2r17 G A 5: 109,575,944 (GRCm39) E272K probably benign Het
Zfp747l1 T A 7: 126,985,716 (GRCm39) probably benign Het
Zfpm2 A G 15: 40,966,008 (GRCm39) D831G probably damaging Het
Other mutations in Mylk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Mylk APN 16 34,759,322 (GRCm39) missense probably benign 0.36
IGL01386:Mylk APN 16 34,791,610 (GRCm39) critical splice acceptor site probably null
IGL01684:Mylk APN 16 34,792,310 (GRCm39) missense possibly damaging 0.55
IGL01884:Mylk APN 16 34,809,247 (GRCm39) splice site probably benign
IGL02079:Mylk APN 16 34,681,001 (GRCm39) missense possibly damaging 0.87
IGL02104:Mylk APN 16 34,635,805 (GRCm39) missense probably benign 0.06
IGL02624:Mylk APN 16 34,750,266 (GRCm39) missense probably benign 0.29
IGL02756:Mylk APN 16 34,784,016 (GRCm39) missense probably benign 0.42
IGL02794:Mylk APN 16 34,806,911 (GRCm39) missense probably benign 0.21
IGL02833:Mylk APN 16 34,735,270 (GRCm39) missense probably benign 0.01
IGL02946:Mylk APN 16 34,742,158 (GRCm39) missense probably benign 0.10
IGL03012:Mylk APN 16 34,773,151 (GRCm39) missense probably benign 0.03
IGL03093:Mylk APN 16 34,732,562 (GRCm39) missense possibly damaging 0.62
IGL03272:Mylk APN 16 34,799,559 (GRCm39) missense probably benign 0.09
billy UTSW 16 34,695,990 (GRCm39) missense probably damaging 0.97
brutus UTSW 16 34,774,065 (GRCm39) missense probably benign 0.12
Club UTSW 16 34,732,645 (GRCm39) nonsense probably null
popeye UTSW 16 34,783,947 (GRCm39) missense probably benign 0.29
F5770:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
P4717OSA:Mylk UTSW 16 34,797,483 (GRCm39) splice site probably benign
PIT4382001:Mylk UTSW 16 34,696,012 (GRCm39) missense probably damaging 0.99
R0131:Mylk UTSW 16 34,695,874 (GRCm39) missense probably benign 0.03
R0309:Mylk UTSW 16 34,732,667 (GRCm39) splice site probably benign
R0358:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0381:Mylk UTSW 16 34,605,344 (GRCm39) splice site probably null
R0390:Mylk UTSW 16 34,695,990 (GRCm39) missense probably damaging 0.97
R0413:Mylk UTSW 16 34,742,314 (GRCm39) missense probably benign 0.01
R0536:Mylk UTSW 16 34,820,757 (GRCm39) missense possibly damaging 0.95
R0544:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0545:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0546:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0547:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0548:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0627:Mylk UTSW 16 34,820,799 (GRCm39) missense probably damaging 1.00
R0726:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0755:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0782:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0783:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0784:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R1136:Mylk UTSW 16 34,820,688 (GRCm39) missense probably damaging 1.00
R1170:Mylk UTSW 16 34,694,409 (GRCm39) missense probably benign 0.20
R1222:Mylk UTSW 16 34,681,022 (GRCm39) missense probably benign 0.12
R1445:Mylk UTSW 16 34,635,835 (GRCm39) missense possibly damaging 0.57
R1583:Mylk UTSW 16 34,695,956 (GRCm39) missense probably benign 0.29
R1618:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R1643:Mylk UTSW 16 34,696,005 (GRCm39) missense probably benign 0.03
R1702:Mylk UTSW 16 34,742,314 (GRCm39) missense probably benign 0.00
R1776:Mylk UTSW 16 34,773,152 (GRCm39) missense probably benign 0.16
R1865:Mylk UTSW 16 34,732,600 (GRCm39) missense probably benign 0.03
R1975:Mylk UTSW 16 34,700,673 (GRCm39) splice site probably null
R2016:Mylk UTSW 16 34,817,187 (GRCm39) missense probably damaging 1.00
R2045:Mylk UTSW 16 34,774,023 (GRCm39) missense probably benign 0.29
R2134:Mylk UTSW 16 34,806,846 (GRCm39) missense probably benign 0.13
R3547:Mylk UTSW 16 34,700,538 (GRCm39) missense possibly damaging 0.61
R3844:Mylk UTSW 16 34,742,247 (GRCm39) missense probably benign 0.01
R4003:Mylk UTSW 16 34,783,947 (GRCm39) missense probably benign 0.29
R4396:Mylk UTSW 16 34,732,645 (GRCm39) nonsense probably null
R4470:Mylk UTSW 16 34,732,522 (GRCm39) missense probably benign 0.09
R4507:Mylk UTSW 16 34,774,065 (GRCm39) missense probably benign 0.12
R4700:Mylk UTSW 16 34,742,805 (GRCm39) missense probably benign 0.16
R4751:Mylk UTSW 16 34,699,539 (GRCm39) missense probably benign 0.29
R4815:Mylk UTSW 16 34,715,295 (GRCm39) missense probably damaging 0.97
R4832:Mylk UTSW 16 34,742,737 (GRCm39) missense probably benign 0.36
R4872:Mylk UTSW 16 34,735,360 (GRCm39) missense possibly damaging 0.89
R4953:Mylk UTSW 16 34,809,331 (GRCm39) missense probably damaging 1.00
R4969:Mylk UTSW 16 34,791,810 (GRCm39) missense probably damaging 0.96
R5009:Mylk UTSW 16 34,719,877 (GRCm39) missense probably benign 0.39
R5130:Mylk UTSW 16 34,809,367 (GRCm39) missense probably damaging 1.00
R5173:Mylk UTSW 16 34,797,383 (GRCm39) missense probably benign 0.40
R5195:Mylk UTSW 16 34,799,585 (GRCm39) missense probably damaging 1.00
R5209:Mylk UTSW 16 34,742,995 (GRCm39) missense possibly damaging 0.55
R5311:Mylk UTSW 16 34,742,127 (GRCm39) missense probably benign 0.01
R5418:Mylk UTSW 16 34,732,600 (GRCm39) missense probably benign 0.02
R5481:Mylk UTSW 16 34,741,974 (GRCm39) missense probably benign 0.09
R5590:Mylk UTSW 16 34,699,722 (GRCm39) missense probably benign 0.29
R5603:Mylk UTSW 16 34,776,862 (GRCm39) missense probably benign 0.06
R5823:Mylk UTSW 16 34,715,317 (GRCm39) critical splice donor site probably null
R6290:Mylk UTSW 16 34,715,213 (GRCm39) missense probably benign 0.39
R6351:Mylk UTSW 16 34,742,341 (GRCm39) missense probably benign 0.01
R6365:Mylk UTSW 16 34,680,961 (GRCm39) missense probably benign 0.12
R6490:Mylk UTSW 16 34,750,237 (GRCm39) missense possibly damaging 0.74
R6723:Mylk UTSW 16 34,750,258 (GRCm39) missense possibly damaging 0.74
R6864:Mylk UTSW 16 34,694,520 (GRCm39) missense probably benign 0.03
R6908:Mylk UTSW 16 34,700,643 (GRCm39) missense probably benign 0.18
R6949:Mylk UTSW 16 34,820,688 (GRCm39) missense probably damaging 1.00
R7018:Mylk UTSW 16 34,820,796 (GRCm39) missense possibly damaging 0.88
R7035:Mylk UTSW 16 34,797,352 (GRCm39) missense possibly damaging 0.89
R7162:Mylk UTSW 16 34,742,899 (GRCm39) missense probably damaging 1.00
R7236:Mylk UTSW 16 34,742,899 (GRCm39) missense probably damaging 1.00
R7269:Mylk UTSW 16 34,605,381 (GRCm39) missense probably damaging 0.96
R7475:Mylk UTSW 16 34,734,446 (GRCm39) splice site probably null
R7525:Mylk UTSW 16 34,809,357 (GRCm39) missense probably benign 0.06
R7587:Mylk UTSW 16 34,742,887 (GRCm39) missense probably benign 0.29
R7607:Mylk UTSW 16 34,715,184 (GRCm39) missense probably benign 0.09
R7616:Mylk UTSW 16 34,699,927 (GRCm39) missense probably damaging 0.97
R7647:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7648:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7764:Mylk UTSW 16 34,742,553 (GRCm39) missense probably benign 0.16
R7890:Mylk UTSW 16 34,784,018 (GRCm39) nonsense probably null
R7892:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R8065:Mylk UTSW 16 34,792,389 (GRCm39) missense probably benign 0.08
R8067:Mylk UTSW 16 34,792,389 (GRCm39) missense probably benign 0.08
R8143:Mylk UTSW 16 34,734,525 (GRCm39) missense possibly damaging 0.87
R8210:Mylk UTSW 16 34,820,721 (GRCm39) missense probably damaging 1.00
R8271:Mylk UTSW 16 34,742,949 (GRCm39) missense probably damaging 0.97
R8540:Mylk UTSW 16 34,750,257 (GRCm39) missense possibly damaging 0.87
R8721:Mylk UTSW 16 34,817,176 (GRCm39) missense probably damaging 1.00
R8743:Mylk UTSW 16 34,741,427 (GRCm39) missense probably benign 0.03
R8798:Mylk UTSW 16 34,719,772 (GRCm39) missense possibly damaging 0.89
R8956:Mylk UTSW 16 34,791,779 (GRCm39) missense probably benign 0.01
R9131:Mylk UTSW 16 34,776,835 (GRCm39) missense probably benign 0.29
R9403:Mylk UTSW 16 34,696,012 (GRCm39) nonsense probably null
R9624:Mylk UTSW 16 34,699,677 (GRCm39) missense probably benign 0.29
R9735:Mylk UTSW 16 34,735,179 (GRCm39) missense probably benign 0.09
R9756:Mylk UTSW 16 34,734,387 (GRCm39) missense probably damaging 0.96
R9763:Mylk UTSW 16 34,699,482 (GRCm39) nonsense probably null
RF001:Mylk UTSW 16 34,699,741 (GRCm39) missense probably benign 0.03
V7580:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
V7583:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
X0065:Mylk UTSW 16 34,820,811 (GRCm39) missense probably damaging 1.00
Z1177:Mylk UTSW 16 34,743,021 (GRCm39) missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- CTTGAAAGTCCAGCCAGAAGC -3'
(R):5'- AAGACCCTGGAAGGAAGCTTC -3'

Sequencing Primer
(F):5'- AGTACCAGCCATAGGGTCCTTC -3'
(R):5'- AAGCTTCCTGGAGGGCCTAG -3'
Posted On 2019-12-20