Incidental Mutation 'R7893:Ttll2'
ID 609474
Institutional Source Beutler Lab
Gene Symbol Ttll2
Ensembl Gene ENSMUSG00000079722
Gene Name tubulin tyrosine ligase-like family, member 2
Synonyms EG625850
MMRRC Submission 045945-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.153) question?
Stock # R7893 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 7618284-7620095 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 7619490 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 146 (T146S)
Ref Sequence ENSEMBL: ENSMUSP00000111413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115747] [ENSMUST00000231397]
AlphaFold A4Q9E4
Predicted Effect probably benign
Transcript: ENSMUST00000115747
AA Change: T146S

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000111413
Gene: ENSMUSG00000079722
AA Change: T146S

DomainStartEndE-ValueType
Pfam:TTL 91 383 1.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231397
Meta Mutation Damage Score 0.2846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,604,440 (GRCm39) I604F probably damaging Het
Adar T A 3: 89,657,958 (GRCm39) D1062E probably damaging Het
Agap2 A G 10: 126,916,064 (GRCm39) T192A unknown Het
Aim2 T C 1: 173,291,492 (GRCm39) V299A possibly damaging Het
Arhgap33 T C 7: 30,228,201 (GRCm39) I394V probably benign Het
Atg2a T C 19: 6,301,326 (GRCm39) F800S probably damaging Het
Btnl10 T A 11: 58,814,635 (GRCm39) N438K probably benign Het
C9 T A 15: 6,512,726 (GRCm39) F283I possibly damaging Het
Camk2n2 T C 16: 20,439,826 (GRCm39) N40S possibly damaging Het
Cd53 T A 3: 106,674,702 (GRCm39) I122F probably benign Het
Col4a1 T C 8: 11,270,243 (GRCm39) D45G unknown Het
Copa T A 1: 171,947,132 (GRCm39) C1085* probably null Het
Cpt1b A G 15: 89,307,857 (GRCm39) probably null Het
Cyp24a1 C G 2: 170,338,436 (GRCm39) probably null Het
Cyp2c40 A T 19: 39,775,292 (GRCm39) V320E probably damaging Het
Efcab3 A C 11: 104,870,186 (GRCm39) S3985R unknown Het
Efcab7 A T 4: 99,746,058 (GRCm39) D210V probably damaging Het
Elfn2 G A 15: 78,557,368 (GRCm39) T393I probably damaging Het
Fbxw11 A T 11: 32,670,489 (GRCm39) I152L probably benign Het
Gab1 A T 8: 81,511,395 (GRCm39) F483L possibly damaging Het
Git2 G T 5: 114,907,737 (GRCm39) R43S possibly damaging Het
Gm43302 G A 5: 105,436,891 (GRCm39) Q72* probably null Het
Hcn2 T C 10: 79,560,245 (GRCm39) L192P probably damaging Het
Htra4 A C 8: 25,523,695 (GRCm39) F290C possibly damaging Het
Ide C T 19: 37,261,550 (GRCm39) V731I Het
Igsf9 T C 1: 172,324,869 (GRCm39) L929P probably damaging Het
Iqgap2 G A 13: 95,826,217 (GRCm39) A535V probably damaging Het
Itga10 T C 3: 96,556,928 (GRCm39) W217R probably damaging Het
Kdm2b A G 5: 123,085,802 (GRCm39) F276L probably benign Het
Klf16 T C 10: 80,412,794 (GRCm39) S81G probably benign Het
L1td1 G T 4: 98,621,978 (GRCm39) C180F possibly damaging Het
Map4k2 A C 19: 6,403,541 (GRCm39) H817P probably damaging Het
Marf1 A T 16: 13,964,599 (GRCm39) V446D probably damaging Het
Mfsd4b1 A G 10: 39,883,313 (GRCm39) S46P probably benign Het
Mylk G C 16: 34,699,894 (GRCm39) S419T probably benign Het
Nckipsd A G 9: 108,692,588 (GRCm39) H604R probably damaging Het
Nedd9 A T 13: 41,469,265 (GRCm39) D629E probably damaging Het
Nlrp5 C T 7: 23,117,590 (GRCm39) T438I probably benign Het
Or4a39 T A 2: 89,237,414 (GRCm39) Q3L probably benign Het
Or51ag1 A T 7: 103,155,817 (GRCm39) I112N possibly damaging Het
Or5p79 A G 7: 108,221,844 (GRCm39) K275R probably damaging Het
Otud7a G T 7: 63,408,300 (GRCm39) D868Y probably damaging Het
Pcdhga6 T C 18: 37,841,066 (GRCm39) L262S probably damaging Het
Plec C T 15: 76,056,732 (GRCm39) V4402I possibly damaging Het
Ppp1r14c A T 10: 3,373,510 (GRCm39) D107V probably damaging Het
Prkg1 A T 19: 30,563,767 (GRCm39) C482S probably damaging Het
Prpf40a A T 2: 53,046,853 (GRCm39) N294K probably benign Het
Rbpj A G 5: 53,803,216 (GRCm39) Y148C probably damaging Het
Rnf19a A G 15: 36,241,814 (GRCm39) S742P possibly damaging Het
Rnf207 T A 4: 152,395,895 (GRCm39) Q533L probably damaging Het
Rsf1 A G 7: 97,311,165 (GRCm39) T632A Het
Rtl1 C T 12: 109,560,355 (GRCm39) V495I possibly damaging Het
Sh2d3c T A 2: 32,639,388 (GRCm39) C491* probably null Het
Sik1 A T 17: 32,069,020 (GRCm39) L285Q probably benign Het
Sipa1l1 T A 12: 82,388,342 (GRCm39) D189E probably benign Het
Slc25a25 G A 2: 32,341,177 (GRCm39) Q54* probably null Het
Slu7 T C 11: 43,335,663 (GRCm39) probably null Het
Sorbs3 T A 14: 70,431,365 (GRCm39) N265I probably benign Het
Spata31g1 T C 4: 42,971,539 (GRCm39) W291R probably damaging Het
Sspo A T 6: 48,440,244 (GRCm39) E1645V probably benign Het
Swap70 A G 7: 109,821,082 (GRCm39) D22G probably benign Het
Ttc34 T C 4: 154,945,757 (GRCm39) C264R probably benign Het
Ttn C T 2: 76,757,548 (GRCm39) E3402K unknown Het
Twf1 A T 15: 94,482,327 (GRCm39) S140T probably benign Het
Vmn1r12 T C 6: 57,136,419 (GRCm39) L172P probably damaging Het
Vmn1r19 T A 6: 57,381,664 (GRCm39) N72K probably damaging Het
Vmn2r17 G A 5: 109,575,944 (GRCm39) E272K probably benign Het
Zfp747l1 T A 7: 126,985,716 (GRCm39) probably benign Het
Zfpm2 A G 15: 40,966,008 (GRCm39) D831G probably damaging Het
Other mutations in Ttll2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02071:Ttll2 APN 17 7,619,130 (GRCm39) missense probably damaging 1.00
IGL03190:Ttll2 APN 17 7,618,779 (GRCm39) missense probably benign 0.05
R1922:Ttll2 UTSW 17 7,619,789 (GRCm39) missense probably damaging 0.99
R2237:Ttll2 UTSW 17 7,619,522 (GRCm39) missense probably benign 0.03
R2892:Ttll2 UTSW 17 7,620,098 (GRCm39) splice site probably null
R4388:Ttll2 UTSW 17 7,618,599 (GRCm39) nonsense probably null
R4389:Ttll2 UTSW 17 7,618,599 (GRCm39) nonsense probably null
R4534:Ttll2 UTSW 17 7,619,120 (GRCm39) missense probably benign 0.02
R4535:Ttll2 UTSW 17 7,619,120 (GRCm39) missense probably benign 0.02
R4536:Ttll2 UTSW 17 7,619,120 (GRCm39) missense probably benign 0.02
R4868:Ttll2 UTSW 17 7,618,998 (GRCm39) missense probably benign 0.07
R4870:Ttll2 UTSW 17 7,618,998 (GRCm39) missense probably benign 0.07
R4871:Ttll2 UTSW 17 7,618,998 (GRCm39) missense probably benign 0.07
R5990:Ttll2 UTSW 17 7,619,766 (GRCm39) missense possibly damaging 0.95
R6145:Ttll2 UTSW 17 7,619,031 (GRCm39) missense probably benign 0.08
R6332:Ttll2 UTSW 17 7,619,167 (GRCm39) missense probably damaging 1.00
R8250:Ttll2 UTSW 17 7,618,767 (GRCm39) missense probably benign 0.00
R8673:Ttll2 UTSW 17 7,619,340 (GRCm39) missense possibly damaging 0.81
R9036:Ttll2 UTSW 17 7,619,054 (GRCm39) missense probably benign 0.01
R9429:Ttll2 UTSW 17 7,620,085 (GRCm39) missense probably damaging 1.00
R9455:Ttll2 UTSW 17 7,619,692 (GRCm39) missense probably damaging 1.00
R9773:Ttll2 UTSW 17 7,618,676 (GRCm39) missense probably benign 0.17
R9784:Ttll2 UTSW 17 7,618,707 (GRCm39) missense probably benign 0.01
RF010:Ttll2 UTSW 17 7,618,737 (GRCm39) missense probably benign 0.05
Z1088:Ttll2 UTSW 17 7,618,925 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCAGTGATGCAGACATAG -3'
(R):5'- AGGGCGGAATATGTCAATGTC -3'

Sequencing Primer
(F):5'- TTTGTACCTACCCACGAGTAAGG -3'
(R):5'- CGGAATATGTCAATGTCAAACCCTGG -3'
Posted On 2019-12-20