Mutagenetix > Incidental Mutation

Incidental Mutation 'R7893:Atg2a'

609478

Institutional Source

Beutler Lab

Gene Symbol

Atg2a

Ensembl Gene

ENSMUSG00000024773

Gene Name

autophagy related 2A

Synonyms

MMRRC Submission

045945-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.322) question?

Stock #

R7893 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

6241668-6262335 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 6251296 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 800 (F800S)

Ref Sequence

ENSEMBL: ENSMUSP00000046412 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045351]

AlphaFold

Q6P4T0

Predicted Effect

probably damaging
Transcript: ENSMUST00000045351
AA Change: F800S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000046412
Gene: ENSMUSG00000024773
AA Change: F800S

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	14	131	7.6e-20	PFAM
low complexity region	138	154	N/A	INTRINSIC
low complexity region	285	301	N/A	INTRINSIC
low complexity region	501	512	N/A	INTRINSIC
low complexity region	852	863	N/A	INTRINSIC
low complexity region	1069	1081	N/A	INTRINSIC
low complexity region	1429	1446	N/A	INTRINSIC
low complexity region	1761	1773	N/A	INTRINSIC
Pfam:ATG_C	1814	1908	2.2e-31	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000114998
Gene: ENSMUSG00000024773
AA Change: F601S

Domain	Start	End	E-Value	Type
low complexity region	87	103	N/A	INTRINSIC
low complexity region	303	314	N/A	INTRINSIC
low complexity region	654	665	N/A	INTRINSIC
low complexity region	871	883	N/A	INTRINSIC
low complexity region	1233	1250	N/A	INTRINSIC
low complexity region	1565	1577	N/A	INTRINSIC
Pfam:ATG_C	1618	1712	3.6e-32	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

99% (70/71)

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	T	C	4: 42,971,539	W291R	probably damaging	Het
9130019O22Rik	T	A	7: 127,386,544		probably benign	Het
Abca3	A	T	17: 24,385,466	I604F	probably damaging	Het
Adar	T	A	3: 89,750,651	D1062E	probably damaging	Het
Agap2	A	G	10: 127,080,195	T192A	unknown	Het
Aim2	T	C	1: 173,463,926	V299A	possibly damaging	Het
Arhgap33	T	C	7: 30,528,776	I394V	probably benign	Het
Btnl10	T	A	11: 58,923,809	N438K	probably benign	Het
C9	T	A	15: 6,483,245	F283I	possibly damaging	Het
Camk2n2	T	C	16: 20,621,076	N40S	possibly damaging	Het
Cd53	T	A	3: 106,767,386	I122F	probably benign	Het
Col4a1	T	C	8: 11,220,243	D45G	unknown	Het
Copa	T	A	1: 172,119,565	C1085*	probably null	Het
Cpt1b	A	G	15: 89,423,654		probably null	Het
Cyp24a1	C	G	2: 170,496,516		probably null	Het
Cyp2c40	A	T	19: 39,786,848	V320E	probably damaging	Het
Efcab7	A	T	4: 99,888,861	D210V	probably damaging	Het
Elfn2	G	A	15: 78,673,168	T393I	probably damaging	Het
Fbxw11	A	T	11: 32,720,489	I152L	probably benign	Het
Gab1	A	T	8: 80,784,766	F483L	possibly damaging	Het
Git2	G	T	5: 114,769,676	R43S	possibly damaging	Het
Gm11639	A	C	11: 104,979,360	S3985R	unknown	Het
Gm43302	G	A	5: 105,289,025	Q72*	probably null	Het
Hcn2	T	C	10: 79,724,411	L192P	probably damaging	Het
Htra4	A	C	8: 25,033,679	F290C	possibly damaging	Het
Ide	C	T	19: 37,284,151	V731I		Het
Igsf9	T	C	1: 172,497,302	L929P	probably damaging	Het
Iqgap2	G	A	13: 95,689,709	A535V	probably damaging	Het
Itga10	T	C	3: 96,649,612	W217R	probably damaging	Het
Kdm2b	A	G	5: 122,947,739	F276L	probably benign	Het
Klf16	T	C	10: 80,576,960	S81G	probably benign	Het
L1td1	G	T	4: 98,733,741	C180F	possibly damaging	Het
Map4k2	A	C	19: 6,353,511	H817P	probably damaging	Het
Marf1	A	T	16: 14,146,735	V446D	probably damaging	Het
Mfsd4b1	A	G	10: 40,007,317	S46P	probably benign	Het
Mylk	G	C	16: 34,879,524	S419T	probably benign	Het
Nckipsd	A	G	9: 108,815,389	H604R	probably damaging	Het
Nedd9	A	T	13: 41,315,789	D629E	probably damaging	Het
Nlrp5	C	T	7: 23,418,165	T438I	probably benign	Het
Olfr1238	T	A	2: 89,407,070	Q3L	probably benign	Het
Olfr507	A	G	7: 108,622,637	K275R	probably damaging	Het
Olfr610	A	T	7: 103,506,610	I112N	possibly damaging	Het
Otud7a	G	T	7: 63,758,552	D868Y	probably damaging	Het
Pcdhga6	T	C	18: 37,708,013	L262S	probably damaging	Het
Plec	C	T	15: 76,172,532	V4402I	possibly damaging	Het
Ppp1r14c	A	T	10: 3,423,510	D107V	probably damaging	Het
Prkg1	A	T	19: 30,586,367	C482S	probably damaging	Het
Prpf40a	A	T	2: 53,156,841	N294K	probably benign	Het
Rbpj	A	G	5: 53,645,874	Y148C	probably damaging	Het
Rnf19a	A	G	15: 36,241,668	S742P	possibly damaging	Het
Rnf207	T	A	4: 152,311,438	Q533L	probably damaging	Het
Rsf1	A	G	7: 97,661,958	T632A		Het
Rtl1	C	T	12: 109,593,921	V495I	possibly damaging	Het
Sh2d3c	T	A	2: 32,749,376	C491*	probably null	Het
Sik1	A	T	17: 31,850,046	L285Q	probably benign	Het
Sipa1l1	T	A	12: 82,341,568	D189E	probably benign	Het
Slc25a25	G	A	2: 32,451,165	Q54*	probably null	Het
Slu7	T	C	11: 43,444,836		probably null	Het
Sorbs3	T	A	14: 70,193,916	N265I	probably benign	Het
Sspo	A	T	6: 48,463,310	E1645V	probably benign	Het
Swap70	A	G	7: 110,221,875	D22G	probably benign	Het
Ttc34	T	C	4: 154,861,300	C264R	probably benign	Het
Ttll2	T	A	17: 7,352,091	T146S	probably benign	Het
Ttn	C	T	2: 76,927,204	E3402K	unknown	Het
Twf1	A	T	15: 94,584,446	S140T	probably benign	Het
Vmn1r12	T	C	6: 57,159,434	L172P	probably damaging	Het
Vmn1r19	T	A	6: 57,404,679	N72K	probably damaging	Het
Vmn2r17	G	A	5: 109,428,078	E272K	probably benign	Het
Zfpm2	A	G	15: 41,102,612	D831G	probably damaging	Het

Other mutations in Atg2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00972:Atg2a	APN	19	6254599	missense	probably damaging	1.00
IGL01612:Atg2a	APN	19	6252484	missense	probably benign	0.03
IGL02105:Atg2a	APN	19	6250403	splice site	probably benign
IGL02151:Atg2a	APN	19	6255757	missense	possibly damaging	0.95
IGL02228:Atg2a	APN	19	6246800	missense	probably benign	0.29
IGL02329:Atg2a	APN	19	6249929	critical splice donor site	probably null
IGL02408:Atg2a	APN	19	6241828	nonsense	probably null
IGL02538:Atg2a	APN	19	6257628	missense	probably benign
IGL02830:Atg2a	APN	19	6247681	missense	probably benign	0.04
IGL03349:Atg2a	APN	19	6258024	missense	possibly damaging	0.77
PIT4515001:Atg2a	UTSW	19	6253585	missense	probably damaging	1.00
R0099:Atg2a	UTSW	19	6252789	missense	probably damaging	0.97
R0212:Atg2a	UTSW	19	6246554	missense	probably damaging	1.00
R0365:Atg2a	UTSW	19	6247683	missense	possibly damaging	0.51
R0398:Atg2a	UTSW	19	6246578	missense	probably damaging	1.00
R0483:Atg2a	UTSW	19	6256601	missense	probably damaging	0.98
R0483:Atg2a	UTSW	19	6256602	missense	probably benign	0.01
R0494:Atg2a	UTSW	19	6253377	missense	probably damaging	1.00
R0511:Atg2a	UTSW	19	6252539	missense	possibly damaging	0.89
R0590:Atg2a	UTSW	19	6245007	unclassified	probably benign
R0592:Atg2a	UTSW	19	6245007	unclassified	probably benign
R0593:Atg2a	UTSW	19	6245007	unclassified	probably benign
R0630:Atg2a	UTSW	19	6244517	missense	probably damaging	0.99
R1306:Atg2a	UTSW	19	6253021	missense	probably benign	0.31
R1437:Atg2a	UTSW	19	6250616	missense	probably damaging	1.00
R1539:Atg2a	UTSW	19	6246771	splice site	probably null
R1774:Atg2a	UTSW	19	6250598	missense	probably benign	0.01
R1781:Atg2a	UTSW	19	6256213	missense	probably damaging	0.96
R1854:Atg2a	UTSW	19	6252431	missense	probably benign	0.11
R1884:Atg2a	UTSW	19	6254384	missense	probably damaging	1.00
R1899:Atg2a	UTSW	19	6245067	missense	probably damaging	1.00
R1935:Atg2a	UTSW	19	6252536	missense	probably damaging	1.00
R2020:Atg2a	UTSW	19	6250269	critical splice donor site	probably null
R2071:Atg2a	UTSW	19	6257458	missense	probably benign	0.00
R2513:Atg2a	UTSW	19	6258046	critical splice donor site	probably null
R3808:Atg2a	UTSW	19	6252816	missense	possibly damaging	0.71
R4065:Atg2a	UTSW	19	6258366	missense	probably damaging	1.00
R4109:Atg2a	UTSW	19	6258374	missense	possibly damaging	0.95
R4352:Atg2a	UTSW	19	6257457	missense	probably benign	0.04
R4440:Atg2a	UTSW	19	6255829	critical splice donor site	probably null
R4472:Atg2a	UTSW	19	6258955	missense	probably damaging	0.98
R4669:Atg2a	UTSW	19	6258987	critical splice donor site	probably null
R4878:Atg2a	UTSW	19	6250244	missense	probably damaging	1.00
R4926:Atg2a	UTSW	19	6257533	missense	probably damaging	0.96
R5237:Atg2a	UTSW	19	6246814	missense	probably benign
R5350:Atg2a	UTSW	19	6251338	missense	probably damaging	0.99
R5507:Atg2a	UTSW	19	6245070	missense	possibly damaging	0.94
R5732:Atg2a	UTSW	19	6257460	missense	probably damaging	1.00
R5784:Atg2a	UTSW	19	6261505	missense	probably damaging	1.00
R5960:Atg2a	UTSW	19	6254360	missense	probably damaging	1.00
R5985:Atg2a	UTSW	19	6254637	missense	probably damaging	1.00
R6175:Atg2a	UTSW	19	6241729	unclassified	probably benign
R6572:Atg2a	UTSW	19	6254665	missense	probably damaging	0.98
R6878:Atg2a	UTSW	19	6250178	missense	probably damaging	0.99
R6879:Atg2a	UTSW	19	6251852	missense	possibly damaging	0.70
R6983:Atg2a	UTSW	19	6260040	missense	probably damaging	0.99
R7024:Atg2a	UTSW	19	6250219	missense	possibly damaging	0.88
R7217:Atg2a	UTSW	19	6253441	critical splice donor site	probably null
R7384:Atg2a	UTSW	19	6261677	missense	probably damaging	1.00
R7387:Atg2a	UTSW	19	6255168	missense	possibly damaging	0.79
R7425:Atg2a	UTSW	19	6255652	missense	probably benign	0.02
R7512:Atg2a	UTSW	19	6260076	missense	probably damaging	1.00
R7658:Atg2a	UTSW	19	6251263	missense	probably damaging	1.00
R8062:Atg2a	UTSW	19	6252579	critical splice donor site	probably null
R8258:Atg2a	UTSW	19	6249829	missense	probably damaging	0.98
R8259:Atg2a	UTSW	19	6249829	missense	probably damaging	0.98
R8350:Atg2a	UTSW	19	6246811	missense	probably benign	0.03
R8412:Atg2a	UTSW	19	6244524	missense	probably damaging	1.00
R8450:Atg2a	UTSW	19	6246811	missense	probably benign	0.03
R8474:Atg2a	UTSW	19	6251403	critical splice donor site	probably null
R8501:Atg2a	UTSW	19	6254390	missense	probably damaging	1.00
R8738:Atg2a	UTSW	19	6256644	missense	probably benign	0.00
R8786:Atg2a	UTSW	19	6244430	missense	probably damaging	1.00
R8810:Atg2a	UTSW	19	6250621	missense	probably benign	0.01
R8898:Atg2a	UTSW	19	6256691	splice site	probably benign
R9016:Atg2a	UTSW	19	6250081	missense	probably damaging	1.00
R9111:Atg2a	UTSW	19	6261504	missense	probably damaging	1.00
R9177:Atg2a	UTSW	19	6241875	missense	probably damaging	1.00
R9184:Atg2a	UTSW	19	6241857	missense	probably damaging	1.00
R9268:Atg2a	UTSW	19	6241875	missense	probably damaging	1.00
R9496:Atg2a	UTSW	19	6259992	missense	possibly damaging	0.63
R9570:Atg2a	UTSW	19	6255719	missense	probably benign	0.03
R9642:Atg2a	UTSW	19	6250168	nonsense	probably null
X0065:Atg2a	UTSW	19	6258196	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- AGGGAGGGATTCTAGGGTACTC -3'
(R):5'- ATCTTGAACCCCGAAGAGCC -3'

Sequencing Primer
(F):5'- AGGGATTCTAGGGTACTCTGTCCC -3'
(R):5'- CCACATGAGCAGGTCGTTATTGATC -3'

Posted On

2019-12-20