Incidental Mutation 'R0142:Phlpp2'
ID 60948
Institutional Source Beutler Lab
Gene Symbol Phlpp2
Ensembl Gene ENSMUSG00000031732
Gene Name PH domain and leucine rich repeat protein phosphatase 2
Synonyms C130044A18Rik, Phlppl
MMRRC Submission 038427-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.249) question?
Stock # R0142 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 110595174-110671303 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 110634145 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 242 (R242W)
Ref Sequence ENSEMBL: ENSMUSP00000136166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034175] [ENSMUST00000179721]
AlphaFold Q8BXA7
Predicted Effect probably damaging
Transcript: ENSMUST00000034175
AA Change: R207W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034175
Gene: ENSMUSG00000031732
AA Change: R207W

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Blast:PH 148 247 3e-61 BLAST
LRR 295 314 1.12e2 SMART
Pfam:LRR_7 319 335 3.5e-2 PFAM
LRR 341 363 2.82e0 SMART
LRR 364 387 9.75e0 SMART
LRR 456 479 2.68e1 SMART
LRR 498 517 1.35e1 SMART
LRR 521 540 5.59e1 SMART
LRR 544 563 2.79e1 SMART
LRR 569 589 1.62e1 SMART
LRR 590 609 1.67e1 SMART
LRR 616 641 1.33e2 SMART
LRR 640 659 1.4e1 SMART
LRR_TYP 664 687 6.78e-3 SMART
LRR 709 733 2.15e2 SMART
PP2Cc 772 1028 2.98e-30 SMART
low complexity region 1061 1095 N/A INTRINSIC
Blast:PP2Cc 1109 1175 8e-15 BLAST
low complexity region 1297 1315 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154262
Predicted Effect probably damaging
Transcript: ENSMUST00000179721
AA Change: R242W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136166
Gene: ENSMUSG00000031732
AA Change: R242W

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 75 92 N/A INTRINSIC
Blast:PH 183 282 4e-61 BLAST
LRR 330 349 1.12e2 SMART
LRR 376 398 2.82e0 SMART
LRR 399 422 9.75e0 SMART
LRR 491 514 2.68e1 SMART
LRR 533 552 1.35e1 SMART
LRR 556 575 5.59e1 SMART
LRR 579 598 2.79e1 SMART
LRR 604 624 1.62e1 SMART
LRR 625 644 1.67e1 SMART
LRR 651 676 1.33e2 SMART
LRR 675 694 1.4e1 SMART
LRR_TYP 699 722 6.78e-3 SMART
LRR 744 768 2.15e2 SMART
PP2Cc 807 1063 2.98e-30 SMART
low complexity region 1096 1130 N/A INTRINSIC
Blast:PP2Cc 1144 1210 8e-15 BLAST
low complexity region 1332 1350 N/A INTRINSIC
Meta Mutation Damage Score 0.3594 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.6%
Validation Efficiency 92% (61/66)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal susceptibility to DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T G 11: 110,079,467 (GRCm39) D1229A probably damaging Het
Abhd8 A C 8: 71,914,506 (GRCm39) F41V probably damaging Het
Ago4 T G 4: 126,410,725 (GRCm39) E222A probably benign Het
Ap3b2 T C 7: 81,122,828 (GRCm39) I470V probably damaging Het
Bcl9l C T 9: 44,418,409 (GRCm39) T749M probably benign Het
Bicc1 T C 10: 70,761,200 (GRCm39) K937E probably damaging Het
Bmi1 G A 2: 18,688,095 (GRCm39) probably null Het
Boc A C 16: 44,310,604 (GRCm39) I772S probably damaging Het
Brd10 A G 19: 29,695,654 (GRCm39) S1347P possibly damaging Het
C2 T A 17: 35,092,504 (GRCm39) I178F possibly damaging Het
Cacna1c G T 6: 118,580,843 (GRCm39) A1416E probably damaging Het
Chst10 A G 1: 38,910,810 (GRCm39) L118P probably damaging Het
Crybg1 G A 10: 43,875,059 (GRCm39) T683I possibly damaging Het
Cul5 C T 9: 53,546,350 (GRCm39) V314I probably damaging Het
Dnajc17 C A 2: 119,010,415 (GRCm39) R211I probably benign Het
Emilin1 A G 5: 31,071,264 (GRCm39) T16A probably benign Het
Ercc6l2 A C 13: 64,020,320 (GRCm39) probably benign Het
Fsd2 T A 7: 81,209,683 (GRCm39) D53V probably damaging Het
Galnt13 A G 2: 54,988,615 (GRCm39) D479G probably damaging Het
Grk3 A T 5: 113,062,919 (GRCm39) W643R probably damaging Het
Hdgf G A 3: 87,820,416 (GRCm39) A4T possibly damaging Het
Hnrnpr T A 4: 136,054,593 (GRCm39) V182E probably damaging Het
Ipo13 A C 4: 117,762,766 (GRCm39) L279R probably damaging Het
Itga9 C A 9: 118,465,654 (GRCm39) N169K probably damaging Het
Jph3 A G 8: 122,480,110 (GRCm39) T263A possibly damaging Het
Jph4 G T 14: 55,345,783 (GRCm39) Q625K probably benign Het
Kctd3 A C 1: 188,728,595 (GRCm39) probably null Het
Kif26b A T 1: 178,742,954 (GRCm39) S570C probably damaging Het
Klhl5 G A 5: 65,300,693 (GRCm39) W164* probably null Het
Lacc1 A T 14: 77,268,239 (GRCm39) H357Q probably benign Het
Lama2 A G 10: 27,063,841 (GRCm39) I1316T probably benign Het
Lcp2 C T 11: 34,032,418 (GRCm39) P332L probably damaging Het
Map3k6 A T 4: 132,978,257 (GRCm39) H1033L probably benign Het
Mfsd2b A G 12: 4,916,234 (GRCm39) V252A probably benign Het
Myo16 T A 8: 10,619,790 (GRCm39) I1447N probably benign Het
Myo19 G A 11: 84,785,429 (GRCm39) R224H probably damaging Het
Myo5a C T 9: 75,067,856 (GRCm39) H637Y probably benign Het
Nek10 C T 14: 14,861,560 (GRCm38) R539C possibly damaging Het
Nfix A T 8: 85,448,315 (GRCm39) V404E probably damaging Het
Nr1i2 T C 16: 38,073,368 (GRCm39) R203G probably benign Het
Nup210l G A 3: 90,079,420 (GRCm39) G968D probably damaging Het
Or10q1 A T 19: 13,726,619 (GRCm39) I50F probably benign Het
Or2ag15 G T 7: 106,340,972 (GRCm39) H56Q probably benign Het
Or8b37 A T 9: 37,959,406 (GRCm39) H296L probably benign Het
Plcz1 A G 6: 139,953,423 (GRCm39) F398S probably damaging Het
Ppfibp2 C A 7: 107,343,384 (GRCm39) P808T probably damaging Het
Srpk2 T C 5: 23,732,928 (GRCm39) K239E probably damaging Het
Svep1 A G 4: 58,118,232 (GRCm39) V830A probably benign Het
Tesc A T 5: 118,194,635 (GRCm39) I149F possibly damaging Het
Thsd7a A G 6: 12,418,334 (GRCm39) W632R probably damaging Het
Tmprss9 A G 10: 80,730,212 (GRCm39) D704G possibly damaging Het
Tob1 T C 11: 94,105,423 (GRCm39) Y320H probably damaging Het
Trpm3 G T 19: 22,965,280 (GRCm39) D1582Y probably damaging Het
Ttc28 A G 5: 111,425,323 (GRCm39) K1716R probably benign Het
Uqcrfs1 A G 13: 30,724,925 (GRCm39) V205A probably benign Het
Usp29 G A 7: 6,965,334 (GRCm39) M392I probably benign Het
Uspl1 A T 5: 149,125,159 (GRCm39) Y22F possibly damaging Het
Virma C A 4: 11,548,783 (GRCm39) N1780K probably benign Het
Vmn1r56 C T 7: 5,199,372 (GRCm39) A82T probably benign Het
Vmn2r5 A T 3: 64,400,009 (GRCm39) C553S probably damaging Het
Vwce A T 19: 10,641,976 (GRCm39) R901W probably damaging Het
Wdpcp C A 11: 21,807,444 (GRCm39) probably null Het
Zfp423 A T 8: 88,506,968 (GRCm39) C1000* probably null Het
Zscan20 A G 4: 128,479,630 (GRCm39) F954L probably benign Het
Other mutations in Phlpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Phlpp2 APN 8 110,652,422 (GRCm39) missense probably benign 0.01
IGL01363:Phlpp2 APN 8 110,663,729 (GRCm39) missense probably benign 0.22
IGL01535:Phlpp2 APN 8 110,660,697 (GRCm39) missense possibly damaging 0.82
IGL01815:Phlpp2 APN 8 110,666,491 (GRCm39) missense probably benign
IGL02105:Phlpp2 APN 8 110,631,040 (GRCm39) missense probably damaging 1.00
IGL02257:Phlpp2 APN 8 110,646,731 (GRCm39) missense possibly damaging 0.88
IGL02318:Phlpp2 APN 8 110,666,505 (GRCm39) missense probably benign 0.04
IGL02500:Phlpp2 APN 8 110,640,250 (GRCm39) missense probably benign
IGL03356:Phlpp2 APN 8 110,662,249 (GRCm39) missense probably benign 0.00
IGL03366:Phlpp2 APN 8 110,667,467 (GRCm39) missense probably benign 0.44
R0144:Phlpp2 UTSW 8 110,634,145 (GRCm39) missense probably damaging 1.00
R0374:Phlpp2 UTSW 8 110,634,145 (GRCm39) missense probably damaging 1.00
R0420:Phlpp2 UTSW 8 110,666,567 (GRCm39) missense probably damaging 0.99
R0426:Phlpp2 UTSW 8 110,655,095 (GRCm39) missense probably benign 0.01
R0477:Phlpp2 UTSW 8 110,622,138 (GRCm39) critical splice acceptor site probably null
R0529:Phlpp2 UTSW 8 110,603,603 (GRCm39) missense probably benign 0.00
R0605:Phlpp2 UTSW 8 110,659,843 (GRCm39) missense probably benign 0.00
R0655:Phlpp2 UTSW 8 110,622,219 (GRCm39) missense probably benign 0.00
R0833:Phlpp2 UTSW 8 110,663,738 (GRCm39) missense probably damaging 1.00
R0836:Phlpp2 UTSW 8 110,663,738 (GRCm39) missense probably damaging 1.00
R1394:Phlpp2 UTSW 8 110,603,662 (GRCm39) nonsense probably null
R1417:Phlpp2 UTSW 8 110,667,313 (GRCm39) nonsense probably null
R1602:Phlpp2 UTSW 8 110,660,655 (GRCm39) missense possibly damaging 0.96
R1650:Phlpp2 UTSW 8 110,660,587 (GRCm39) splice site probably benign
R1815:Phlpp2 UTSW 8 110,666,855 (GRCm39) missense probably damaging 1.00
R2045:Phlpp2 UTSW 8 110,634,232 (GRCm39) missense probably damaging 1.00
R2072:Phlpp2 UTSW 8 110,655,124 (GRCm39) missense possibly damaging 0.88
R2074:Phlpp2 UTSW 8 110,655,124 (GRCm39) missense possibly damaging 0.88
R2075:Phlpp2 UTSW 8 110,655,124 (GRCm39) missense possibly damaging 0.88
R2433:Phlpp2 UTSW 8 110,666,634 (GRCm39) missense probably damaging 1.00
R3028:Phlpp2 UTSW 8 110,634,245 (GRCm39) missense probably damaging 1.00
R4611:Phlpp2 UTSW 8 110,603,515 (GRCm39) missense possibly damaging 0.79
R4718:Phlpp2 UTSW 8 110,667,452 (GRCm39) missense probably benign 0.31
R4739:Phlpp2 UTSW 8 110,667,052 (GRCm39) missense probably damaging 1.00
R4857:Phlpp2 UTSW 8 110,603,642 (GRCm39) missense probably damaging 1.00
R5020:Phlpp2 UTSW 8 110,666,714 (GRCm39) missense probably damaging 1.00
R5047:Phlpp2 UTSW 8 110,640,251 (GRCm39) missense probably benign 0.04
R5074:Phlpp2 UTSW 8 110,652,461 (GRCm39) missense probably damaging 0.99
R5330:Phlpp2 UTSW 8 110,660,667 (GRCm39) missense probably damaging 0.99
R5663:Phlpp2 UTSW 8 110,630,976 (GRCm39) missense probably benign 0.01
R5668:Phlpp2 UTSW 8 110,655,205 (GRCm39) missense possibly damaging 0.67
R6433:Phlpp2 UTSW 8 110,661,317 (GRCm39) missense probably benign
R6470:Phlpp2 UTSW 8 110,663,826 (GRCm39) missense probably benign 0.45
R6804:Phlpp2 UTSW 8 110,655,197 (GRCm39) missense probably damaging 1.00
R7012:Phlpp2 UTSW 8 110,603,486 (GRCm39) missense possibly damaging 0.95
R7183:Phlpp2 UTSW 8 110,666,585 (GRCm39) missense probably damaging 1.00
R7257:Phlpp2 UTSW 8 110,666,820 (GRCm39) missense probably benign
R7312:Phlpp2 UTSW 8 110,666,785 (GRCm39) missense probably damaging 0.96
R7349:Phlpp2 UTSW 8 110,655,278 (GRCm39) missense probably damaging 0.98
R7801:Phlpp2 UTSW 8 110,652,474 (GRCm39) missense possibly damaging 0.56
R8059:Phlpp2 UTSW 8 110,622,189 (GRCm39) missense probably benign 0.00
R8174:Phlpp2 UTSW 8 110,595,321 (GRCm39) missense unknown
R8242:Phlpp2 UTSW 8 110,666,834 (GRCm39) missense probably benign 0.03
R8488:Phlpp2 UTSW 8 110,640,202 (GRCm39) missense probably benign
R8688:Phlpp2 UTSW 8 110,631,012 (GRCm39) missense probably damaging 1.00
R8843:Phlpp2 UTSW 8 110,652,431 (GRCm39) missense probably benign 0.18
R9154:Phlpp2 UTSW 8 110,666,590 (GRCm39) missense possibly damaging 0.82
R9556:Phlpp2 UTSW 8 110,666,758 (GRCm39) missense probably benign
R9737:Phlpp2 UTSW 8 110,663,714 (GRCm39) missense probably damaging 0.99
R9781:Phlpp2 UTSW 8 110,662,178 (GRCm39) missense possibly damaging 0.95
R9786:Phlpp2 UTSW 8 110,660,655 (GRCm39) nonsense probably null
X0018:Phlpp2 UTSW 8 110,639,001 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGTCTGCCAAGATTCAGAAGC -3'
(R):5'- GATGGTCACTTGCTGCTACATCCTC -3'

Sequencing Primer
(F):5'- catgtacccccacatccag -3'
(R):5'- GCTACATCCTCATCTCTATCCAAG -3'
Posted On 2013-07-24