Mutagenetix > Incidental Mutations

Incidental Mutation 'R0681:Rasal2'

60953

Institutional Source

Beutler Lab

Gene Symbol

Rasal2

Ensembl Gene

ENSMUSG00000070565

Gene Name

RAS protein activator like 2

Synonyms

A330066M24Rik

MMRRC Submission

038866-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0681 (G1)

Quality Score

178

Status

Validated

Chromosome

Chromosomal Location

157135182-157412595 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 157157180 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 999 (D999G)

Ref Sequence

ENSEMBL: ENSMUSP00000077423 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078308] [ENSMUST00000132699]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000078308
AA Change: D999G

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000077423
Gene: ENSMUSG00000070565
AA Change: D999G

Domain	Start	End	E-Value	Type
low complexity region	36	47	N/A	INTRINSIC
PH	58	307	3.97e-8	SMART
C2	317	413	6.01e-10	SMART
RasGAP	423	767	4.56e-157	SMART
low complexity region	780	791	N/A	INTRINSIC
low complexity region	1063	1075	N/A	INTRINSIC
low complexity region	1084	1092	N/A	INTRINSIC
coiled coil region	1117	1236	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000132699
AA Change: D974G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000114964
Gene: ENSMUSG00000070565
AA Change: D974G

Domain	Start	End	E-Value	Type
low complexity region	18	29	N/A	INTRINSIC
PH	40	289	1.7e-10	SMART
C2	299	395	4e-12	SMART
RasGAP	405	742	4.2e-153	SMART
low complexity region	755	766	N/A	INTRINSIC
low complexity region	1038	1050	N/A	INTRINSIC
low complexity region	1059	1067	N/A	INTRINSIC
coiled coil region	1092	1211	N/A	INTRINSIC

Meta Mutation Damage Score

0.0835

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.3%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains the GAP-related domain (GRD), a characteristic domain of GTPase-activating proteins (GAPs). GAPs function as activators of Ras superfamily of small GTPases. The protein encoded by this gene is able to complement the defective RasGAP function in a yeast system. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit reduced survival and decreased tumor latency. In other tumorigenic models, this allele promotes increase metastatic potential. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl1	G	T	8: 83,934,650		probably benign	Het
Adgrv1	C	A	13: 81,528,530	D1341Y	probably damaging	Het
Ahdc1	T	C	4: 133,065,516	F1356S	possibly damaging	Het
BC027072	T	G	17: 71,749,514	H1056P	probably benign	Het
Cdk13	A	G	13: 17,721,297		probably benign	Het
Cfhr1	A	T	1: 139,557,511	S66T	probably damaging	Het
Cldn6	C	A	17: 23,681,193	Q44K	probably damaging	Het
Cntnap5c	T	C	17: 58,305,555	V863A	possibly damaging	Het
Col6a4	T	A	9: 106,067,144	K1044*	probably null	Het
Cyb561d1	A	G	3: 108,199,267	V212A	probably benign	Het
Cyp1b1	A	G	17: 79,713,846	S156P	probably damaging	Het
Dock7	G	A	4: 99,016,704	H645Y	probably damaging	Het
Dpp3	T	C	19: 4,914,654	N542D	probably damaging	Het
Fastkd3	C	T	13: 68,591,928		probably benign	Het
Galnt10	T	A	11: 57,769,540	V268D	probably damaging	Het
Gm13078	A	T	4: 143,728,052	T307S	probably benign	Het
Grb14	G	T	2: 64,917,287	A10E	probably damaging	Het
Grin2c	A	G	11: 115,249,653	V1213A	probably benign	Het
Grip1	C	T	10: 120,010,230	T570I	probably damaging	Het
Hif1an	T	C	19: 44,563,323	Y71H	probably benign	Het
Hsd17b11	T	A	5: 104,003,206	I221L	probably benign	Het
Htra1	A	T	7: 130,979,297		probably benign	Het
Igfn1	T	C	1: 135,963,853	E2308G	possibly damaging	Het
Mapk9	T	A	11: 49,869,245	S129T	probably damaging	Het
Med22	T	C	2: 26,910,379	T13A	probably benign	Het
Miox	C	T	15: 89,336,274	L189F	possibly damaging	Het
Mtus1	A	T	8: 40,993,517	L489Q	probably damaging	Het
Naprt	G	A	15: 75,893,632	P120S	probably damaging	Het
Nwd1	C	T	8: 72,662,337	P172L	probably damaging	Het
Ogfod2	A	G	5: 124,112,844	E62G	probably null	Het
Olfr1445	T	C	19: 12,884,079	L66P	probably damaging	Het
Olfr1445	A	G	19: 12,884,546	T222A	probably damaging	Het
Olfr211	A	T	6: 116,494,400	S264C	probably damaging	Het
Palm	A	C	10: 79,819,493	T362P	probably benign	Het
Pcdh8	T	C	14: 79,769,960	T388A	probably benign	Het
Pclo	A	G	5: 14,675,318	I1397V	unknown	Het
Per1	A	G	11: 69,101,201	E127G	probably damaging	Het
Plekha1	T	C	7: 130,900,623	V30A	possibly damaging	Het
Rab26	A	G	17: 24,527,966		probably benign	Het
Rfx5	C	T	3: 94,956,355	T105I	probably damaging	Het
Rrp1b	T	C	17: 32,060,395	S677P	probably damaging	Het
Scaf4	G	A	16: 90,249,694	P485S	unknown	Het
Scn5a	A	T	9: 119,539,640	M273K	probably damaging	Het
Sec22a	C	T	16: 35,361,556		probably null	Het
Slc10a6	C	A	5: 103,612,449	V227F	possibly damaging	Het
Slc39a3	C	G	10: 81,033,731	E31Q	probably benign	Het
Spsb1	C	T	4: 149,906,917	V65I	probably benign	Het
Tdrd7	T	A	4: 46,016,879	M673K	probably benign	Het
Trim8	C	A	19: 46,515,093	S361R	possibly damaging	Het
Ucp1	T	A	8: 83,295,307	M256K	possibly damaging	Het
Vmn1r46	A	T	6: 89,976,964	D265V	probably damaging	Het
Zbtb5	T	C	4: 44,993,787	I532M	probably damaging	Het

Other mutations in Rasal2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00473:Rasal2	APN	1	157147817	missense	probably benign
IGL00484:Rasal2	APN	1	157174175	unclassified	probably null
IGL00731:Rasal2	APN	1	157157764	missense	probably benign	0.01
IGL00900:Rasal2	APN	1	157411929	missense	possibly damaging	0.73
IGL01346:Rasal2	APN	1	157161216	missense	probably benign	0.19
IGL01635:Rasal2	APN	1	157163824	missense	probably damaging	1.00
IGL01759:Rasal2	APN	1	157175932	missense	probably benign	0.42
IGL01939:Rasal2	APN	1	157175910	missense	probably damaging	1.00
IGL01954:Rasal2	APN	1	157177699	missense	possibly damaging	0.83
IGL01954:Rasal2	APN	1	157176116	missense	probably damaging	0.99
IGL02005:Rasal2	APN	1	157156998	nonsense	probably null
IGL02056:Rasal2	APN	1	157299261	missense	probably damaging	0.99
IGL02444:Rasal2	APN	1	157299195	missense	probably benign	0.20
IGL02496:Rasal2	APN	1	157149879	missense	possibly damaging	0.69
IGL02832:Rasal2	APN	1	157157207	missense	probably damaging	1.00
IGL03351:Rasal2	APN	1	157192741	splice site	probably benign
R0456:Rasal2	UTSW	1	157149843	missense	probably damaging	1.00
R0537:Rasal2	UTSW	1	157147792	missense	possibly damaging	0.46
R0682:Rasal2	UTSW	1	157179209	missense	probably damaging	1.00
R0683:Rasal2	UTSW	1	157179209	missense	probably damaging	1.00
R0787:Rasal2	UTSW	1	157158696	missense	probably damaging	1.00
R0789:Rasal2	UTSW	1	157157321	missense	probably damaging	1.00
R1109:Rasal2	UTSW	1	157177638	unclassified	probably benign
R1175:Rasal2	UTSW	1	157147648	missense	probably damaging	1.00
R1332:Rasal2	UTSW	1	157175821	missense	probably benign	0.00
R1396:Rasal2	UTSW	1	157164666	missense	probably damaging	1.00
R1535:Rasal2	UTSW	1	157230059	missense	probably benign	0.28
R1542:Rasal2	UTSW	1	157175851	missense	possibly damaging	0.84
R1703:Rasal2	UTSW	1	157157600	missense	probably damaging	1.00
R1735:Rasal2	UTSW	1	157174160	missense	probably damaging	1.00
R1762:Rasal2	UTSW	1	157299144	missense	possibly damaging	0.52
R2570:Rasal2	UTSW	1	157161300	missense	possibly damaging	0.85
R3148:Rasal2	UTSW	1	157243764	intron	probably benign
R3157:Rasal2	UTSW	1	157158655	splice site	probably benign
R4277:Rasal2	UTSW	1	157157126	missense	possibly damaging	0.46
R4459:Rasal2	UTSW	1	157175832	missense	possibly damaging	0.46
R4460:Rasal2	UTSW	1	157175832	missense	possibly damaging	0.46
R4563:Rasal2	UTSW	1	157175991	missense	probably damaging	1.00
R4672:Rasal2	UTSW	1	157243661	missense	probably benign	0.10
R4894:Rasal2	UTSW	1	157192804	missense	probably damaging	0.97
R5147:Rasal2	UTSW	1	157175694	missense	probably damaging	1.00
R5387:Rasal2	UTSW	1	157157765	missense	possibly damaging	0.81
R5421:Rasal2	UTSW	1	157299141	missense	probably benign	0.37
R5459:Rasal2	UTSW	1	157157661	missense	probably damaging	0.99
R5651:Rasal2	UTSW	1	157157381	missense	probably damaging	1.00
R5767:Rasal2	UTSW	1	157176162	missense	probably damaging	1.00
R5778:Rasal2	UTSW	1	157161290	missense	probably damaging	1.00
R6298:Rasal2	UTSW	1	157411862	missense	possibly damaging	0.85
R6332:Rasal2	UTSW	1	157299187	missense	probably damaging	1.00
R6571:Rasal2	UTSW	1	157161179	missense	possibly damaging	0.72
R7258:Rasal2	UTSW	1	157157700	missense	probably damaging	0.96
R7545:Rasal2	UTSW	1	157192769	missense	possibly damaging	0.93
R7558:Rasal2	UTSW	1	157175836	missense	probably damaging	0.99
RF024:Rasal2	UTSW	1	157147790	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- CGTTCTGCACAGGTTCAGCCATTAG -3'
(R):5'- GGAAGTCTCCAGCCCTTGTCATTC -3'

Sequencing Primer
(F):5'- TTCAGCCATTAGGGCTGC -3'
(R):5'- GTTCCAGCAATGCCAAAGG -3'

Posted On

2013-07-30