Incidental Mutation 'R7894:Mia2'
ID609538
Institutional Source Beutler Lab
Gene Symbol Mia2
Ensembl Gene ENSMUSG00000021000
Gene Namemelanoma inhibitory activity 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R7894 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location59095799-59191583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59189647 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 712 (Y712H)
Ref Sequence ENSEMBL: ENSMUSP00000135245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069430] [ENSMUST00000170992] [ENSMUST00000175877] [ENSMUST00000175912] [ENSMUST00000176322] [ENSMUST00000176336] [ENSMUST00000176464] [ENSMUST00000176752] [ENSMUST00000176892] [ENSMUST00000177162] [ENSMUST00000177225] [ENSMUST00000219140]
Predicted Effect probably damaging
Transcript: ENSMUST00000069430
AA Change: Y745H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070572
Gene: ENSMUSG00000021000
AA Change: Y745H

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
SCOP:d1fxkc_ 124 253 9e-6 SMART
SCOP:d1fxkc_ 314 437 3e-16 SMART
low complexity region 480 493 N/A INTRINSIC
low complexity region 533 556 N/A INTRINSIC
low complexity region 682 700 N/A INTRINSIC
low complexity region 707 717 N/A INTRINSIC
low complexity region 722 742 N/A INTRINSIC
low complexity region 751 775 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170992
AA Change: Y723H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126538
Gene: ENSMUSG00000021000
AA Change: Y723H

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 102 231 2e-6 SMART
SCOP:d1fxkc_ 292 415 2e-17 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 511 534 N/A INTRINSIC
low complexity region 660 678 N/A INTRINSIC
low complexity region 685 695 N/A INTRINSIC
low complexity region 700 720 N/A INTRINSIC
low complexity region 729 753 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175685
Predicted Effect probably damaging
Transcript: ENSMUST00000175877
AA Change: Y652H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135440
Gene: ENSMUSG00000021000
AA Change: Y652H

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d1fxkc_ 74 203 1e-5 SMART
SCOP:d1fxkc_ 264 387 6e-16 SMART
low complexity region 430 443 N/A INTRINSIC
low complexity region 589 607 N/A INTRINSIC
low complexity region 614 624 N/A INTRINSIC
low complexity region 629 649 N/A INTRINSIC
low complexity region 658 682 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175912
AA Change: Y736H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135251
Gene: ENSMUSG00000021000
AA Change: Y736H

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
SCOP:d1fxkc_ 115 244 8e-6 SMART
SCOP:d1fxkc_ 305 428 2e-16 SMART
low complexity region 471 484 N/A INTRINSIC
low complexity region 524 547 N/A INTRINSIC
low complexity region 673 691 N/A INTRINSIC
low complexity region 698 708 N/A INTRINSIC
low complexity region 713 733 N/A INTRINSIC
low complexity region 742 766 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176322
AA Change: Y756H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135100
Gene: ENSMUSG00000021000
AA Change: Y756H

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 135 264 4e-6 SMART
SCOP:d1fxkc_ 325 448 9e-17 SMART
low complexity region 491 504 N/A INTRINSIC
low complexity region 544 567 N/A INTRINSIC
low complexity region 693 711 N/A INTRINSIC
low complexity region 718 728 N/A INTRINSIC
low complexity region 733 753 N/A INTRINSIC
low complexity region 762 786 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176336
SMART Domains Protein: ENSMUSP00000134872
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
coiled coil region 55 235 N/A INTRINSIC
SCOP:d1fxkc_ 281 404 6e-8 SMART
low complexity region 447 460 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176464
AA Change: Y747H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135390
Gene: ENSMUSG00000021000
AA Change: Y747H

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 126 255 4e-6 SMART
SCOP:d1fxkc_ 316 439 8e-17 SMART
low complexity region 482 495 N/A INTRINSIC
low complexity region 535 558 N/A INTRINSIC
low complexity region 684 702 N/A INTRINSIC
low complexity region 709 719 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 753 777 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176617
Predicted Effect probably benign
Transcript: ENSMUST00000176752
SMART Domains Protein: ENSMUSP00000134972
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176892
AA Change: Y712H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135245
Gene: ENSMUSG00000021000
AA Change: Y712H

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
SCOP:d1fxkc_ 91 220 4e-6 SMART
SCOP:d1fxkc_ 281 404 8e-17 SMART
low complexity region 447 460 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
low complexity region 649 667 N/A INTRINSIC
low complexity region 674 684 N/A INTRINSIC
low complexity region 689 709 N/A INTRINSIC
low complexity region 718 742 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177162
AA Change: Y704H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135001
Gene: ENSMUSG00000021000
AA Change: Y704H

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 126 255 2e-5 SMART
SCOP:d1fxkc_ 316 439 8e-16 SMART
low complexity region 482 495 N/A INTRINSIC
low complexity region 641 659 N/A INTRINSIC
low complexity region 666 676 N/A INTRINSIC
low complexity region 681 701 N/A INTRINSIC
low complexity region 710 734 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177222
Predicted Effect probably damaging
Transcript: ENSMUST00000177225
AA Change: Y676H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135618
Gene: ENSMUSG00000021000
AA Change: Y676H

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
SCOP:d1fxkc_ 98 227 3e-5 SMART
SCOP:d1fxkc_ 288 411 2e-15 SMART
low complexity region 454 467 N/A INTRINSIC
low complexity region 613 631 N/A INTRINSIC
low complexity region 638 648 N/A INTRINSIC
low complexity region 653 673 N/A INTRINSIC
low complexity region 682 706 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000219140
AA Change: Y1348H

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in endoplasmic reticulum-to-Golgi trafficking and regulation of cholesterol metabolism. Three major classes of transcripts are generated from this gene- melanoma inhibitory activity 2-specific transcripts, cTAGE family member 5-specific transcripts and transcripts that include exons from both these transcript species. Additionally, alternative splicing in these transcripts results in multiple transcript variants encoding diverse isoforms. A mutation in this gene (couch-potato or cpto) may result in low levels of plasma cholesterol and triglycerides. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit decreased serum levels of cholesterol, HDL cholesterol, triglyceride, and VLDL triglyceride. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,106,589 M1551T possibly damaging Het
Abcc9 A G 6: 142,594,007 *1547Q probably null Het
Adamts20 A C 15: 94,351,760 C459G probably damaging Het
Adamts5 C T 16: 85,877,920 W452* probably null Het
Adcy8 G T 15: 64,920,205 Q301K possibly damaging Het
Adgrv1 A C 13: 81,567,451 C873G probably benign Het
AI314180 T C 4: 58,853,708 N361S probably damaging Het
Ak9 A G 10: 41,420,539 D1427G unknown Het
Amy2a1 T A 3: 113,530,541 M117L possibly damaging Het
Ap5z1 G T 5: 142,466,284 R23L probably benign Het
Ap5z1 C T 5: 142,470,436 Q337* probably null Het
Astn1 C A 1: 158,601,938 Q759K probably damaging Het
Cd276 T A 9: 58,537,479 T70S possibly damaging Het
Cd38 C T 5: 43,900,404 T106I probably damaging Het
Cdon C G 9: 35,476,948 R740G probably damaging Het
Clk2 C T 3: 89,168,894 R124W possibly damaging Het
Cyp1b1 C T 17: 79,714,215 V33M possibly damaging Het
Dab1 T A 4: 104,732,138 D547E probably benign Het
Degs1 A T 1: 182,276,851 Y290N probably damaging Het
Degs1 G C 1: 182,276,852 H289Q probably benign Het
Dopey2 T A 16: 93,810,204 C2249S probably benign Het
Ehd4 A C 2: 120,102,428 Y172* probably null Het
Erc2 A G 14: 27,777,208 D347G probably damaging Het
Espl1 T G 15: 102,304,025 V522G probably damaging Het
Fabp9 T A 3: 10,197,167 T10S probably benign Het
Fam193a T C 5: 34,440,533 I558T possibly damaging Het
Fhod1 T C 8: 105,331,157 E912G probably damaging Het
Gja1 T C 10: 56,388,549 F335L possibly damaging Het
Gm14025 A C 2: 129,037,129 V959G unknown Het
Gm29106 A G 1: 118,199,535 H319R probably damaging Het
Hunk C T 16: 90,472,465 S299F probably damaging Het
Hydin C T 8: 110,513,010 T1974M possibly damaging Het
Ighv10-1 T A 12: 114,479,030 T112S probably damaging Het
Ireb2 T A 9: 54,882,336 V98E probably damaging Het
Irf4 A C 13: 30,753,452 H167P probably benign Het
Irf6 C T 1: 193,162,713 P164L probably benign Het
Josd1 A G 15: 79,677,250 I119T probably damaging Het
Kcna5 G T 6: 126,535,048 T39K probably damaging Het
Klhl24 A G 16: 20,123,000 D566G probably damaging Het
Kmt2a T A 9: 44,849,857 K232* probably null Het
Krt36 A G 11: 100,105,235 L121P probably damaging Het
Lama3 A T 18: 12,462,807 H931L probably benign Het
Lamp3 A T 16: 19,655,391 I411N probably damaging Het
Lingo3 C T 10: 80,834,776 W440* probably null Het
Mlh1 T A 9: 111,230,077 probably null Het
Mta3 T A 17: 83,762,934 S174T probably benign Het
Myo15 A G 11: 60,491,137 T347A Het
Naaladl2 C T 3: 23,846,554 R704H possibly damaging Het
Nfib T C 4: 82,327,793 N394S probably benign Het
Nr2f2 A G 7: 70,359,933 Y133H probably damaging Het
Olfr1220 A G 2: 89,097,588 V113A possibly damaging Het
Olfr1314 A T 2: 112,092,477 C75S probably benign Het
Olfr320 C T 11: 58,684,674 S267F possibly damaging Het
Olfr486 T A 7: 108,172,184 M187L probably benign Het
Olfr94 C T 17: 37,197,156 E196K probably damaging Het
Phgdh C A 3: 98,339,808 V9L probably damaging Het
Pkd2 T A 5: 104,480,237 D392E probably damaging Het
Plekhm3 A G 1: 64,921,715 S461P probably benign Het
Prss39 A G 1: 34,500,227 T183A probably benign Het
Pter T A 2: 12,994,755 I235K probably damaging Het
Ptp4a3 T C 15: 73,756,907 V172A probably benign Het
Rasa2 T C 9: 96,602,727 N145D probably benign Het
Rasal2 A T 1: 157,243,648 H45Q probably benign Het
Rbm43 A G 2: 51,925,897 V104A probably damaging Het
Rhbdd2 C A 5: 135,639,115 probably null Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rimbp2 T A 5: 128,761,464 N1023I probably damaging Het
Rtl1 A T 12: 109,594,597 D269E possibly damaging Het
Sbp A G 17: 23,942,189 probably benign Het
Sorbs1 T A 19: 40,327,576 T374S probably benign Het
Tgs1 A T 4: 3,598,652 K655I probably benign Het
Thsd1 A C 8: 22,259,569 T819P probably damaging Het
Tmprss11c C T 5: 86,231,796 V418M probably damaging Het
Top2a A T 11: 99,009,605 D645E probably damaging Het
Top2b G A 14: 16,413,081 V997I possibly damaging Het
Ttc34 A G 4: 154,859,383 D118G probably damaging Het
Ttll5 A G 12: 85,889,174 D353G probably damaging Het
Uba6 A T 5: 86,118,065 Y994* probably null Het
Vmn1r189 A T 13: 22,101,736 Y310* probably null Het
Vps13c T A 9: 67,926,983 I1644N probably damaging Het
Zfp811 T C 17: 32,798,847 D73G possibly damaging Het
Zfp951 A T 5: 104,814,972 C243S probably benign Het
Other mutations in Mia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Mia2 APN 12 59160273 splice site probably benign
IGL00791:Mia2 APN 12 59108299 missense possibly damaging 0.82
IGL00821:Mia2 APN 12 59170320 critical splice donor site probably null
IGL00901:Mia2 APN 12 59108029 missense probably damaging 1.00
IGL00985:Mia2 APN 12 59188360 missense probably damaging 1.00
IGL01304:Mia2 APN 12 59104538 missense probably damaging 1.00
IGL01909:Mia2 APN 12 59107945 missense possibly damaging 0.94
IGL02646:Mia2 APN 12 59108836 missense probably damaging 1.00
IGL02800:Mia2 APN 12 59188491 nonsense probably null
IGL03332:Mia2 APN 12 59108398 missense probably damaging 0.97
PIT4812001:Mia2 UTSW 12 59101579 missense possibly damaging 0.92
R0242:Mia2 UTSW 12 59108856 missense probably damaging 1.00
R0242:Mia2 UTSW 12 59108856 missense probably damaging 1.00
R0449:Mia2 UTSW 12 59172594 critical splice donor site probably null
R0620:Mia2 UTSW 12 59154419 missense possibly damaging 0.96
R0622:Mia2 UTSW 12 59131578 missense probably damaging 0.98
R0632:Mia2 UTSW 12 59136143 missense probably damaging 0.99
R1643:Mia2 UTSW 12 59179845 splice site probably null
R1654:Mia2 UTSW 12 59108833 missense possibly damaging 0.92
R1706:Mia2 UTSW 12 59144766 nonsense probably null
R1776:Mia2 UTSW 12 59149575 splice site probably benign
R1848:Mia2 UTSW 12 59170251 splice site probably benign
R2240:Mia2 UTSW 12 59107882 missense probably benign 0.01
R2698:Mia2 UTSW 12 59170994 critical splice donor site probably null
R2860:Mia2 UTSW 12 59154410 missense probably damaging 0.98
R2861:Mia2 UTSW 12 59154410 missense probably damaging 0.98
R2862:Mia2 UTSW 12 59154410 missense probably damaging 0.98
R3429:Mia2 UTSW 12 59189641 missense possibly damaging 0.89
R3861:Mia2 UTSW 12 59109021 missense probably benign 0.00
R3965:Mia2 UTSW 12 59176372 missense probably damaging 1.00
R5156:Mia2 UTSW 12 59172537 missense possibly damaging 0.94
R5249:Mia2 UTSW 12 59108125 missense probably damaging 0.99
R5330:Mia2 UTSW 12 59095812 missense probably benign 0.01
R5331:Mia2 UTSW 12 59095812 missense probably benign 0.01
R5815:Mia2 UTSW 12 59174106 missense possibly damaging 0.95
R5972:Mia2 UTSW 12 59146937 missense probably damaging 1.00
R6651:Mia2 UTSW 12 59154362 missense possibly damaging 0.78
R6676:Mia2 UTSW 12 59108370 missense probably damaging 0.97
R6695:Mia2 UTSW 12 59172580 missense probably damaging 0.99
R6800:Mia2 UTSW 12 59188546 critical splice donor site probably null
R6845:Mia2 UTSW 12 59184278 nonsense probably null
R6919:Mia2 UTSW 12 59129895 missense possibly damaging 0.74
R7058:Mia2 UTSW 12 59184235 missense possibly damaging 0.77
R7209:Mia2 UTSW 12 59154390 missense possibly damaging 0.55
R7274:Mia2 UTSW 12 59108119 missense probably damaging 0.99
R7291:Mia2 UTSW 12 59158369 critical splice donor site probably null
R7874:Mia2 UTSW 12 59108588 missense probably damaging 0.99
R7961:Mia2 UTSW 12 59159639 critical splice donor site probably null
R7980:Mia2 UTSW 12 59108865 missense probably damaging 0.98
R8110:Mia2 UTSW 12 59109087 splice site probably null
R8557:Mia2 UTSW 12 59101488 missense probably damaging 0.97
X0063:Mia2 UTSW 12 59136139 missense probably damaging 0.99
Z1176:Mia2 UTSW 12 59108124 missense probably benign 0.27
Z1176:Mia2 UTSW 12 59108801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTAGCTGCTAAGATAGGAC -3'
(R):5'- AAGACGTAACGCTGTCAGG -3'

Sequencing Primer
(F):5'- CTGCTAAGATAGGACAAACGTACCTG -3'
(R):5'- TAACGCTGTCAGGCCTCC -3'
Posted On2019-12-20