Incidental Mutation 'R0681:Grb14'
ID60954
Institutional Source Beutler Lab
Gene Symbol Grb14
Ensembl Gene ENSMUSG00000026888
Gene Namegrowth factor receptor bound protein 14
Synonyms
MMRRC Submission 038866-MU
Accession Numbers

Ncbi RefSeq: NM_016719.1; MGI:1355324

Is this an essential gene? Probably non essential (E-score: 0.225) question?
Stock #R0681 (G1)
Quality Score141
Status Validated
Chromosome2
Chromosomal Location64912476-65024987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 64917287 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 10 (A10E)
Ref Sequence ENSEMBL: ENSMUSP00000121571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028252] [ENSMUST00000149193] [ENSMUST00000150643]
Predicted Effect probably damaging
Transcript: ENSMUST00000028252
AA Change: A376E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028252
Gene: ENSMUSG00000026888
AA Change: A376E

DomainStartEndE-ValueType
RA 104 190 2.88e-23 SMART
PH 233 342 1.91e-10 SMART
Pfam:BPS 367 415 1.5e-31 PFAM
SH2 435 524 5.34e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134020
Predicted Effect probably benign
Transcript: ENSMUST00000149193
SMART Domains Protein: ENSMUSP00000118115
Gene: ENSMUSG00000026888

DomainStartEndE-ValueType
Pfam:BPS 1 24 3e-13 PFAM
SH2 44 108 2.54e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000150643
AA Change: A10E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121571
Gene: ENSMUSG00000026888
AA Change: A10E

DomainStartEndE-ValueType
Pfam:BPS 1 49 3.1e-34 PFAM
SCOP:d1a81a2 51 93 3e-8 SMART
Blast:RA 61 93 1e-12 BLAST
PDB:2AUG|B 65 93 4e-12 PDB
Meta Mutation Damage Score 0.5655 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency 100% (68/68)
MGI Phenotype Strain: 3029164
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to a small family of adapter proteins that are known to interact with a number of receptor tyrosine kinases and signaling molecules. This gene encodes a growth factor receptor-binding protein that interacts with insulin receptors and insulin-like growth-factor receptors. This protein likely has an inhibitory effect on receptor tyrosine kinase signaling and, in particular, on insulin receptor signaling. This gene may play a role in signaling pathways that regulate growth and metabolism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous mutation of this gene results in improved glucose tolerance, lower circulating insulin levels and increased incorporation of glucose into glycogen in the liver and skeletal muscle of males. Both males and females exhibit a decrease in body size. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 G T 8: 83,934,650 probably benign Het
Adgrv1 C A 13: 81,528,530 D1341Y probably damaging Het
Ahdc1 T C 4: 133,065,516 F1356S possibly damaging Het
BC027072 T G 17: 71,749,514 H1056P probably benign Het
Cdk13 A G 13: 17,721,297 probably benign Het
Cfhr1 A T 1: 139,557,511 S66T probably damaging Het
Cldn6 C A 17: 23,681,193 Q44K probably damaging Het
Cntnap5c T C 17: 58,305,555 V863A possibly damaging Het
Col6a4 T A 9: 106,067,144 K1044* probably null Het
Cyb561d1 A G 3: 108,199,267 V212A probably benign Het
Cyp1b1 A G 17: 79,713,846 S156P probably damaging Het
Dock7 G A 4: 99,016,704 H645Y probably damaging Het
Dpp3 T C 19: 4,914,654 N542D probably damaging Het
Fastkd3 C T 13: 68,591,928 probably benign Het
Galnt10 T A 11: 57,769,540 V268D probably damaging Het
Gm13078 A T 4: 143,728,052 T307S probably benign Het
Grin2c A G 11: 115,249,653 V1213A probably benign Het
Grip1 C T 10: 120,010,230 T570I probably damaging Het
Hif1an T C 19: 44,563,323 Y71H probably benign Het
Hsd17b11 T A 5: 104,003,206 I221L probably benign Het
Htra1 A T 7: 130,979,297 probably benign Het
Igfn1 T C 1: 135,963,853 E2308G possibly damaging Het
Mapk9 T A 11: 49,869,245 S129T probably damaging Het
Med22 T C 2: 26,910,379 T13A probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mtus1 A T 8: 40,993,517 L489Q probably damaging Het
Naprt G A 15: 75,893,632 P120S probably damaging Het
Nwd1 C T 8: 72,662,337 P172L probably damaging Het
Ogfod2 A G 5: 124,112,844 E62G probably null Het
Olfr1445 T C 19: 12,884,079 L66P probably damaging Het
Olfr1445 A G 19: 12,884,546 T222A probably damaging Het
Olfr211 A T 6: 116,494,400 S264C probably damaging Het
Palm A C 10: 79,819,493 T362P probably benign Het
Pcdh8 T C 14: 79,769,960 T388A probably benign Het
Pclo A G 5: 14,675,318 I1397V unknown Het
Per1 A G 11: 69,101,201 E127G probably damaging Het
Plekha1 T C 7: 130,900,623 V30A possibly damaging Het
Rab26 A G 17: 24,527,966 probably benign Het
Rasal2 T C 1: 157,157,180 D999G possibly damaging Het
Rfx5 C T 3: 94,956,355 T105I probably damaging Het
Rrp1b T C 17: 32,060,395 S677P probably damaging Het
Scaf4 G A 16: 90,249,694 P485S unknown Het
Scn5a A T 9: 119,539,640 M273K probably damaging Het
Sec22a C T 16: 35,361,556 probably null Het
Slc10a6 C A 5: 103,612,449 V227F possibly damaging Het
Slc39a3 C G 10: 81,033,731 E31Q probably benign Het
Spsb1 C T 4: 149,906,917 V65I probably benign Het
Tdrd7 T A 4: 46,016,879 M673K probably benign Het
Trim8 C A 19: 46,515,093 S361R possibly damaging Het
Ucp1 T A 8: 83,295,307 M256K possibly damaging Het
Vmn1r46 A T 6: 89,976,964 D265V probably damaging Het
Zbtb5 T C 4: 44,993,787 I532M probably damaging Het
Other mutations in Grb14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Grb14 APN 2 64914718 missense probably damaging 1.00
IGL02267:Grb14 APN 2 64953616 missense probably damaging 1.00
IGL02902:Grb14 APN 2 64938418 missense probably damaging 1.00
R0066:Grb14 UTSW 2 64938492 critical splice acceptor site probably null
R0066:Grb14 UTSW 2 64938492 critical splice acceptor site probably null
R0658:Grb14 UTSW 2 64914727 nonsense probably null
R1215:Grb14 UTSW 2 64917264 missense probably benign 0.01
R1781:Grb14 UTSW 2 64975555 critical splice donor site probably null
R1932:Grb14 UTSW 2 64912802 missense probably damaging 1.00
R2034:Grb14 UTSW 2 64923529 splice site probably benign
R4405:Grb14 UTSW 2 64953622 missense probably damaging 1.00
R4505:Grb14 UTSW 2 65022568 missense probably damaging 0.97
R4580:Grb14 UTSW 2 64953603 missense probably benign 0.29
R5216:Grb14 UTSW 2 64917309 missense probably benign 0.00
R5367:Grb14 UTSW 2 64917309 missense probably benign 0.00
R5369:Grb14 UTSW 2 64917309 missense probably benign 0.00
R5382:Grb14 UTSW 2 64914734 missense probably damaging 1.00
R5457:Grb14 UTSW 2 64917098 missense probably damaging 1.00
R5816:Grb14 UTSW 2 64917284 missense probably damaging 1.00
R6062:Grb14 UTSW 2 65022620 missense possibly damaging 0.77
R7114:Grb14 UTSW 2 64916853 missense probably damaging 1.00
X0021:Grb14 UTSW 2 64936425 missense probably null 0.26
Predicted Primers PCR Primer
(F):5'- GTCCCATCCCATGTGACCGTATCTA -3'
(R):5'- atgacacttacagggacccTGGCA -3'

Sequencing Primer
(F):5'- GTGATTCCCCAGGCGTAAAC -3'
(R):5'- gggacccTGGCAGCATC -3'
Posted On2013-07-30