Incidental Mutation 'R7894:Top2b'
ID 609545
Institutional Source Beutler Lab
Gene Symbol Top2b
Ensembl Gene ENSMUSG00000017485
Gene Name topoisomerase (DNA) II beta
Synonyms D230016L12Rik, Top-2
MMRRC Submission 045946-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.888) question?
Stock # R7894 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 16365179-16435462 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 16413081 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 997 (V997I)
Ref Sequence ENSEMBL: ENSMUSP00000017629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017629] [ENSMUST00000161693]
AlphaFold Q64511
Predicted Effect possibly damaging
Transcript: ENSMUST00000017629
AA Change: V997I

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: V997I

DomainStartEndE-ValueType
Blast:TOP2c 32 70 7e-10 BLAST
HATPase_c 85 234 1.91e-2 SMART
TOP2c 89 679 N/A SMART
TOP4c 702 1175 2.55e-230 SMART
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1287 1299 N/A INTRINSIC
low complexity region 1324 1336 N/A INTRINSIC
low complexity region 1360 1382 N/A INTRINSIC
Pfam:DTHCT 1495 1597 4.6e-31 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000124889
Gene: ENSMUSG00000017485
AA Change: V139I

DomainStartEndE-ValueType
TOP4c 2 222 3.97e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161693
SMART Domains Protein: ENSMUSP00000123992
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
Pfam:DNA_topoisoIV 1 117 1.2e-12 PFAM
low complexity region 161 173 N/A INTRINSIC
low complexity region 198 210 N/A INTRINSIC
low complexity region 234 256 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,106,589 M1551T possibly damaging Het
Abcc9 A G 6: 142,594,007 *1547Q probably null Het
Adamts20 A C 15: 94,351,760 C459G probably damaging Het
Adamts5 C T 16: 85,877,920 W452* probably null Het
Adcy8 G T 15: 64,920,205 Q301K possibly damaging Het
Adgrv1 A C 13: 81,567,451 C873G probably benign Het
AI314180 T C 4: 58,853,708 N361S probably damaging Het
Ak9 A G 10: 41,420,539 D1427G unknown Het
Amy2a1 T A 3: 113,530,541 M117L possibly damaging Het
Ap5z1 C T 5: 142,470,436 Q337* probably null Het
Ap5z1 G T 5: 142,466,284 R23L probably benign Het
Astn1 C A 1: 158,601,938 Q759K probably damaging Het
Cd276 T A 9: 58,537,479 T70S possibly damaging Het
Cd38 C T 5: 43,900,404 T106I probably damaging Het
Cdon C G 9: 35,476,948 R740G probably damaging Het
Clk2 C T 3: 89,168,894 R124W possibly damaging Het
Cyp1b1 C T 17: 79,714,215 V33M possibly damaging Het
Dab1 T A 4: 104,732,138 D547E probably benign Het
Degs1 G C 1: 182,276,852 H289Q probably benign Het
Degs1 A T 1: 182,276,851 Y290N probably damaging Het
Dopey2 T A 16: 93,810,204 C2249S probably benign Het
Ehd4 A C 2: 120,102,428 Y172* probably null Het
Erc2 A G 14: 27,777,208 D347G probably damaging Het
Espl1 T G 15: 102,304,025 V522G probably damaging Het
Fabp9 T A 3: 10,197,167 T10S probably benign Het
Fam193a T C 5: 34,440,533 I558T possibly damaging Het
Fhod1 T C 8: 105,331,157 E912G probably damaging Het
Gja1 T C 10: 56,388,549 F335L possibly damaging Het
Gm14025 A C 2: 129,037,129 V959G unknown Het
Gm29106 A G 1: 118,199,535 H319R probably damaging Het
Hunk C T 16: 90,472,465 S299F probably damaging Het
Hydin C T 8: 110,513,010 T1974M possibly damaging Het
Ighv10-1 T A 12: 114,479,030 T112S probably damaging Het
Ireb2 T A 9: 54,882,336 V98E probably damaging Het
Irf4 A C 13: 30,753,452 H167P probably benign Het
Irf6 C T 1: 193,162,713 P164L probably benign Het
Josd1 A G 15: 79,677,250 I119T probably damaging Het
Kcna5 G T 6: 126,535,048 T39K probably damaging Het
Klhl24 A G 16: 20,123,000 D566G probably damaging Het
Kmt2a T A 9: 44,849,857 K232* probably null Het
Krt36 A G 11: 100,105,235 L121P probably damaging Het
Lama3 A T 18: 12,462,807 H931L probably benign Het
Lamp3 A T 16: 19,655,391 I411N probably damaging Het
Lingo3 C T 10: 80,834,776 W440* probably null Het
Mia2 T C 12: 59,189,647 Y712H probably damaging Het
Mlh1 T A 9: 111,230,077 probably null Het
Mta3 T A 17: 83,762,934 S174T probably benign Het
Myo15 A G 11: 60,491,137 T347A Het
Naaladl2 C T 3: 23,846,554 R704H possibly damaging Het
Nfib T C 4: 82,327,793 N394S probably benign Het
Nr2f2 A G 7: 70,359,933 Y133H probably damaging Het
Olfr1220 A G 2: 89,097,588 V113A possibly damaging Het
Olfr1314 A T 2: 112,092,477 C75S probably benign Het
Olfr320 C T 11: 58,684,674 S267F possibly damaging Het
Olfr486 T A 7: 108,172,184 M187L probably benign Het
Olfr94 C T 17: 37,197,156 E196K probably damaging Het
Phgdh C A 3: 98,339,808 V9L probably damaging Het
Pkd2 T A 5: 104,480,237 D392E probably damaging Het
Plekhm3 A G 1: 64,921,715 S461P probably benign Het
Prss39 A G 1: 34,500,227 T183A probably benign Het
Pter T A 2: 12,994,755 I235K probably damaging Het
Ptp4a3 T C 15: 73,756,907 V172A probably benign Het
Rasa2 T C 9: 96,602,727 N145D probably benign Het
Rasal2 A T 1: 157,243,648 H45Q probably benign Het
Rbm43 A G 2: 51,925,897 V104A probably damaging Het
Rhbdd2 C A 5: 135,639,115 probably null Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rimbp2 T A 5: 128,761,464 N1023I probably damaging Het
Rtl1 A T 12: 109,594,597 D269E possibly damaging Het
Sbp A G 17: 23,942,189 probably benign Het
Sorbs1 T A 19: 40,327,576 T374S probably benign Het
Tgs1 A T 4: 3,598,652 K655I probably benign Het
Thsd1 A C 8: 22,259,569 T819P probably damaging Het
Tmprss11c C T 5: 86,231,796 V418M probably damaging Het
Top2a A T 11: 99,009,605 D645E probably damaging Het
Ttc34 A G 4: 154,859,383 D118G probably damaging Het
Ttll5 A G 12: 85,889,174 D353G probably damaging Het
Uba6 A T 5: 86,118,065 Y994* probably null Het
Vmn1r189 A T 13: 22,101,736 Y310* probably null Het
Vps13c T A 9: 67,926,983 I1644N probably damaging Het
Zfp811 T C 17: 32,798,847 D73G possibly damaging Het
Zfp951 A T 5: 104,814,972 C243S probably benign Het
Other mutations in Top2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Top2b APN 14 16422692 missense probably benign 0.00
IGL00730:Top2b APN 14 16389831 missense probably damaging 1.00
IGL00917:Top2b APN 14 16407354 missense probably benign 0.05
IGL01959:Top2b APN 14 16422695 missense probably benign 0.19
IGL02019:Top2b APN 14 16409965 missense probably benign 0.44
IGL02119:Top2b APN 14 16406733 missense probably damaging 1.00
IGL02136:Top2b APN 14 16407103 unclassified probably benign
IGL02148:Top2b APN 14 16400488 missense probably damaging 1.00
IGL02496:Top2b APN 14 16387335 missense probably benign
IGL02503:Top2b APN 14 16407163 missense possibly damaging 0.92
IGL02672:Top2b APN 14 16409166 unclassified probably benign
IGL02721:Top2b APN 14 16409236 missense probably damaging 1.00
IGL02886:Top2b APN 14 16365688 missense possibly damaging 0.73
IGL03252:Top2b APN 14 16393163 missense possibly damaging 0.60
PIT4434001:Top2b UTSW 14 16423780 critical splice donor site probably null
R0092:Top2b UTSW 14 16409263 missense probably damaging 1.00
R0201:Top2b UTSW 14 16383174 missense probably damaging 1.00
R0390:Top2b UTSW 14 16418442 missense probably benign 0.00
R0394:Top2b UTSW 14 16413556 splice site probably null
R1159:Top2b UTSW 14 16430329 missense possibly damaging 0.81
R1424:Top2b UTSW 14 16383177 missense probably damaging 1.00
R1519:Top2b UTSW 14 16408953 splice site probably null
R1561:Top2b UTSW 14 16398993 missense possibly damaging 0.80
R1713:Top2b UTSW 14 16409823 missense probably benign 0.05
R1987:Top2b UTSW 14 16398916 missense probably damaging 0.99
R2219:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2287:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2422:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2679:Top2b UTSW 14 16413947 missense probably damaging 1.00
R3687:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3707:Top2b UTSW 14 16388447 missense probably damaging 1.00
R3810:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3812:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3815:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3816:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3818:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4023:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4025:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4026:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4133:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4157:Top2b UTSW 14 16384491 missense probably benign 0.42
R4179:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4180:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4300:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4376:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4377:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4492:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4549:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4550:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4581:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4582:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4628:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4630:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4667:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4668:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4669:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4698:Top2b UTSW 14 16387331 nonsense probably null
R4769:Top2b UTSW 14 16398991 missense probably damaging 1.00
R4809:Top2b UTSW 14 16383125 missense probably benign 0.06
R4899:Top2b UTSW 14 16387313 missense probably damaging 1.00
R5035:Top2b UTSW 14 16409966 missense probably benign 0.01
R5621:Top2b UTSW 14 16387280 missense probably damaging 1.00
R5631:Top2b UTSW 14 16409882 missense probably damaging 1.00
R5685:Top2b UTSW 14 16413666 missense probably damaging 1.00
R5732:Top2b UTSW 14 16400106 missense possibly damaging 0.92
R5939:Top2b UTSW 14 16422786 missense probably damaging 0.96
R6007:Top2b UTSW 14 16423779 critical splice donor site probably null
R6087:Top2b UTSW 14 16409864 missense probably benign 0.14
R6144:Top2b UTSW 14 16423740 missense possibly damaging 0.48
R6196:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6218:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6229:Top2b UTSW 14 16409838 missense probably damaging 1.00
R6249:Top2b UTSW 14 16399006 missense probably damaging 1.00
R6337:Top2b UTSW 14 16399026 missense possibly damaging 0.77
R6353:Top2b UTSW 14 16416671 missense probably damaging 1.00
R6512:Top2b UTSW 14 16409854 missense possibly damaging 0.94
R6573:Top2b UTSW 14 16398991 missense probably damaging 1.00
R6614:Top2b UTSW 14 16407142 nonsense probably null
R6844:Top2b UTSW 14 16429383 missense possibly damaging 0.94
R6848:Top2b UTSW 14 16409958 missense possibly damaging 0.89
R6871:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6895:Top2b UTSW 14 16413604 missense probably benign 0.06
R7162:Top2b UTSW 14 16416653 missense probably benign 0.00
R7247:Top2b UTSW 14 16416962 missense probably benign 0.08
R7250:Top2b UTSW 14 16420411 missense probably benign
R7359:Top2b UTSW 14 16407376 missense probably null 1.00
R7365:Top2b UTSW 14 16416649 missense probably benign 0.04
R7493:Top2b UTSW 14 16416605 missense probably benign 0.00
R7528:Top2b UTSW 14 16395427 nonsense probably null
R7562:Top2b UTSW 14 16412946 missense probably benign 0.04
R7594:Top2b UTSW 14 16428587 missense probably benign
R7670:Top2b UTSW 14 16416620 missense possibly damaging 0.61
R8031:Top2b UTSW 14 16412986 missense probably damaging 0.98
R8150:Top2b UTSW 14 16393291 missense probably damaging 0.99
R8214:Top2b UTSW 14 16383177 missense probably damaging 1.00
R8299:Top2b UTSW 14 16386123 missense possibly damaging 0.68
R8977:Top2b UTSW 14 16393239 missense probably benign 0.36
R9562:Top2b UTSW 14 16365718 missense probably benign 0.09
R9565:Top2b UTSW 14 16365718 missense probably benign 0.09
R9798:Top2b UTSW 14 16389845 missense probably damaging 1.00
X0028:Top2b UTSW 14 16384499 nonsense probably null
Z1176:Top2b UTSW 14 16395434 missense probably damaging 1.00
Z1177:Top2b UTSW 14 16416953 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTTCCTAGGTATACAAGGAGCAGG -3'
(R):5'- TGAATATGTACTACCCCTGAAACC -3'

Sequencing Primer
(F):5'- CAGGTCCTAGAACCTATGCTTAATGG -3'
(R):5'- CATACTATTCTTGCAGAAGACCTGAG -3'
Posted On 2019-12-20