Incidental Mutation 'R0681:Rfx5'
ID60955
Institutional Source Beutler Lab
Gene Symbol Rfx5
Ensembl Gene ENSMUSG00000005774
Gene Nameregulatory factor X, 5 (influences HLA class II expression)
Synonyms
MMRRC Submission 038866-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R0681 (G1)
Quality Score95
Status Validated
Chromosome3
Chromosomal Location94954075-94961561 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 94956355 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 105 (T105I)
Ref Sequence ENSEMBL: ENSMUSP00000118586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029772] [ENSMUST00000107253] [ENSMUST00000107254] [ENSMUST00000107255] [ENSMUST00000107260] [ENSMUST00000132393] [ENSMUST00000137088] [ENSMUST00000140331] [ENSMUST00000142311] [ENSMUST00000144132] [ENSMUST00000145031] [ENSMUST00000145472] [ENSMUST00000147237] [ENSMUST00000152869]
Predicted Effect probably damaging
Transcript: ENSMUST00000029772
AA Change: T105I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029772
Gene: ENSMUSG00000005774
AA Change: T105I

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 84 169 7.2e-33 PFAM
RFX5_DNA_bdg 438 656 4.29e-130 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107253
AA Change: T105I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102874
Gene: ENSMUSG00000005774
AA Change: T105I

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 84 169 1.8e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107254
AA Change: T105I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102875
Gene: ENSMUSG00000005774
AA Change: T105I

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 84 169 1.8e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107255
AA Change: T105I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102876
Gene: ENSMUSG00000005774
AA Change: T105I

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 84 169 7.2e-33 PFAM
RFX5_DNA_bdg 438 656 4.29e-130 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107260
AA Change: T105I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102881
Gene: ENSMUSG00000005774
AA Change: T105I

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 88 167 5.3e-31 PFAM
RFX5_DNA_bdg 438 656 4.29e-130 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125186
Predicted Effect probably benign
Transcript: ENSMUST00000132393
SMART Domains Protein: ENSMUSP00000117999
Gene: ENSMUSG00000005774

DomainStartEndE-ValueType
PDB:2KW3|B 23 89 9e-40 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000137088
AA Change: T105I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117963
Gene: ENSMUSG00000005774
AA Change: T105I

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 84 169 7.2e-33 PFAM
RFX5_DNA_bdg 438 656 4.29e-130 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140294
Predicted Effect probably benign
Transcript: ENSMUST00000140331
Predicted Effect probably damaging
Transcript: ENSMUST00000142311
AA Change: T105I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119704
Gene: ENSMUSG00000005774
AA Change: T105I

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 84 131 4.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142708
Predicted Effect probably benign
Transcript: ENSMUST00000144132
Predicted Effect probably damaging
Transcript: ENSMUST00000145031
AA Change: T105I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118099
Gene: ENSMUSG00000005774
AA Change: T105I

DomainStartEndE-ValueType
PDB:2KW3|B 23 89 9e-40 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000145472
Predicted Effect probably damaging
Transcript: ENSMUST00000147237
AA Change: T105I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118586
Gene: ENSMUSG00000005774
AA Change: T105I

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 84 169 8.7e-34 PFAM
Pfam:Pox_D5 88 159 1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148803
Predicted Effect probably benign
Transcript: ENSMUST00000152869
SMART Domains Protein: ENSMUSP00000121157
Gene: ENSMUSG00000005774

DomainStartEndE-ValueType
PDB:2KW3|B 23 89 7e-40 PDB
Meta Mutation Damage Score 0.5354 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency 100% (68/68)
MGI Phenotype PHENOTYPE: Homozygous null mice have absent or decreased expression of MHC-II complexes on antigen presenting cells, which leads to reduced numbers of CD4+ thymocytes and T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 G T 8: 83,934,650 probably benign Het
Adgrv1 C A 13: 81,528,530 D1341Y probably damaging Het
Ahdc1 T C 4: 133,065,516 F1356S possibly damaging Het
BC027072 T G 17: 71,749,514 H1056P probably benign Het
Cdk13 A G 13: 17,721,297 probably benign Het
Cfhr1 A T 1: 139,557,511 S66T probably damaging Het
Cldn6 C A 17: 23,681,193 Q44K probably damaging Het
Cntnap5c T C 17: 58,305,555 V863A possibly damaging Het
Col6a4 T A 9: 106,067,144 K1044* probably null Het
Cyb561d1 A G 3: 108,199,267 V212A probably benign Het
Cyp1b1 A G 17: 79,713,846 S156P probably damaging Het
Dock7 G A 4: 99,016,704 H645Y probably damaging Het
Dpp3 T C 19: 4,914,654 N542D probably damaging Het
Fastkd3 C T 13: 68,591,928 probably benign Het
Galnt10 T A 11: 57,769,540 V268D probably damaging Het
Gm13078 A T 4: 143,728,052 T307S probably benign Het
Grb14 G T 2: 64,917,287 A10E probably damaging Het
Grin2c A G 11: 115,249,653 V1213A probably benign Het
Grip1 C T 10: 120,010,230 T570I probably damaging Het
Hif1an T C 19: 44,563,323 Y71H probably benign Het
Hsd17b11 T A 5: 104,003,206 I221L probably benign Het
Htra1 A T 7: 130,979,297 probably benign Het
Igfn1 T C 1: 135,963,853 E2308G possibly damaging Het
Mapk9 T A 11: 49,869,245 S129T probably damaging Het
Med22 T C 2: 26,910,379 T13A probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mtus1 A T 8: 40,993,517 L489Q probably damaging Het
Naprt G A 15: 75,893,632 P120S probably damaging Het
Nwd1 C T 8: 72,662,337 P172L probably damaging Het
Ogfod2 A G 5: 124,112,844 E62G probably null Het
Olfr1445 T C 19: 12,884,079 L66P probably damaging Het
Olfr1445 A G 19: 12,884,546 T222A probably damaging Het
Olfr211 A T 6: 116,494,400 S264C probably damaging Het
Palm A C 10: 79,819,493 T362P probably benign Het
Pcdh8 T C 14: 79,769,960 T388A probably benign Het
Pclo A G 5: 14,675,318 I1397V unknown Het
Per1 A G 11: 69,101,201 E127G probably damaging Het
Plekha1 T C 7: 130,900,623 V30A possibly damaging Het
Rab26 A G 17: 24,527,966 probably benign Het
Rasal2 T C 1: 157,157,180 D999G possibly damaging Het
Rrp1b T C 17: 32,060,395 S677P probably damaging Het
Scaf4 G A 16: 90,249,694 P485S unknown Het
Scn5a A T 9: 119,539,640 M273K probably damaging Het
Sec22a C T 16: 35,361,556 probably null Het
Slc10a6 C A 5: 103,612,449 V227F possibly damaging Het
Slc39a3 C G 10: 81,033,731 E31Q probably benign Het
Spsb1 C T 4: 149,906,917 V65I probably benign Het
Tdrd7 T A 4: 46,016,879 M673K probably benign Het
Trim8 C A 19: 46,515,093 S361R possibly damaging Het
Ucp1 T A 8: 83,295,307 M256K possibly damaging Het
Vmn1r46 A T 6: 89,976,964 D265V probably damaging Het
Zbtb5 T C 4: 44,993,787 I532M probably damaging Het
Other mutations in Rfx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Rfx5 APN 3 94957775 unclassified probably benign
IGL01478:Rfx5 APN 3 94958440 missense possibly damaging 0.88
IGL02061:Rfx5 APN 3 94958481 missense probably benign 0.03
IGL02152:Rfx5 APN 3 94957182 missense probably damaging 1.00
IGL03395:Rfx5 APN 3 94957802 nonsense probably null
chip UTSW 3 94956355 missense probably damaging 1.00
nonplussed UTSW 3 94958961 missense unknown
shrunken UTSW 3 94955143 missense probably damaging 1.00
R0098:Rfx5 UTSW 3 94958368 missense probably damaging 1.00
R0098:Rfx5 UTSW 3 94958368 missense probably damaging 1.00
R0505:Rfx5 UTSW 3 94956355 missense probably damaging 1.00
R1342:Rfx5 UTSW 3 94958412 missense probably benign 0.09
R1460:Rfx5 UTSW 3 94956325 missense probably damaging 1.00
R1466:Rfx5 UTSW 3 94956303 missense probably damaging 1.00
R1466:Rfx5 UTSW 3 94956303 missense probably damaging 1.00
R1972:Rfx5 UTSW 3 94957292 missense probably damaging 1.00
R2173:Rfx5 UTSW 3 94956716 unclassified probably null
R4808:Rfx5 UTSW 3 94958280 missense probably benign 0.03
R4993:Rfx5 UTSW 3 94955815 missense probably benign 0.27
R4996:Rfx5 UTSW 3 94955815 missense probably benign 0.27
R5104:Rfx5 UTSW 3 94955140 missense probably benign 0.35
R5912:Rfx5 UTSW 3 94958718 unclassified probably benign
R7097:Rfx5 UTSW 3 94956539 missense probably damaging 1.00
R7186:Rfx5 UTSW 3 94958348 missense probably benign 0.01
R7194:Rfx5 UTSW 3 94955143 missense probably damaging 1.00
R7202:Rfx5 UTSW 3 94958961 missense unknown
R7203:Rfx5 UTSW 3 94958876 missense unknown
R7374:Rfx5 UTSW 3 94958742 missense unknown
R7375:Rfx5 UTSW 3 94958742 missense unknown
RF061:Rfx5 UTSW 3 94955759 missense probably damaging 1.00
Z1176:Rfx5 UTSW 3 94955815 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GGGACAAACTGATTCGATCTGGCAC -3'
(R):5'- TCCAGGCAATGGTGGCATGGATAC -3'

Sequencing Primer
(F):5'- GATTCGATCTGGCACCATCAAAG -3'
(R):5'- GTCCTAATCTCTGGGTCAAGGATAC -3'
Posted On2013-07-30