Incidental Mutation 'R7894:Espl1'
ID 609552
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Name extra spindle pole bodies 1, separase
Synonyms ESP1, SSE, separase, PRCE, Cerp, PRCE
MMRRC Submission 045946-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7894 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 102204701-102232792 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 102212460 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 522 (V522G)
Ref Sequence ENSEMBL: ENSMUSP00000064465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]
AlphaFold P60330
Predicted Effect probably damaging
Transcript: ENSMUST00000064924
AA Change: V522G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: V522G

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229050
AA Change: V522G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 109,997,415 (GRCm39) M1551T possibly damaging Het
Abcc9 A G 6: 142,539,733 (GRCm39) *1547Q probably null Het
Adamts20 A C 15: 94,249,641 (GRCm39) C459G probably damaging Het
Adamts5 C T 16: 85,674,808 (GRCm39) W452* probably null Het
Adcy8 G T 15: 64,792,054 (GRCm39) Q301K possibly damaging Het
Adgrv1 A C 13: 81,715,570 (GRCm39) C873G probably benign Het
Ak9 A G 10: 41,296,535 (GRCm39) D1427G unknown Het
Amy2a1 T A 3: 113,324,190 (GRCm39) M117L possibly damaging Het
Ap5z1 G T 5: 142,452,039 (GRCm39) R23L probably benign Het
Ap5z1 C T 5: 142,456,191 (GRCm39) Q337* probably null Het
Astn1 C A 1: 158,429,508 (GRCm39) Q759K probably damaging Het
Cd276 T A 9: 58,444,762 (GRCm39) T70S possibly damaging Het
Cd38 C T 5: 44,057,746 (GRCm39) T106I probably damaging Het
Cdon C G 9: 35,388,244 (GRCm39) R740G probably damaging Het
Clk2 C T 3: 89,076,201 (GRCm39) R124W possibly damaging Het
Cyp1b1 C T 17: 80,021,644 (GRCm39) V33M possibly damaging Het
Dab1 T A 4: 104,589,335 (GRCm39) D547E probably benign Het
Degs1 A T 1: 182,104,416 (GRCm39) Y290N probably damaging Het
Degs1 G C 1: 182,104,417 (GRCm39) H289Q probably benign Het
Dop1b T A 16: 93,607,092 (GRCm39) C2249S probably benign Het
Ecpas T C 4: 58,853,708 (GRCm39) N361S probably damaging Het
Ehd4 A C 2: 119,932,909 (GRCm39) Y172* probably null Het
Erc2 A G 14: 27,499,165 (GRCm39) D347G probably damaging Het
Fabp9 T A 3: 10,262,227 (GRCm39) T10S probably benign Het
Fam193a T C 5: 34,597,877 (GRCm39) I558T possibly damaging Het
Fhod1 T C 8: 106,057,789 (GRCm39) E912G probably damaging Het
Gja1 T C 10: 56,264,645 (GRCm39) F335L possibly damaging Het
Gm29106 A G 1: 118,127,265 (GRCm39) H319R probably damaging Het
Hunk C T 16: 90,269,353 (GRCm39) S299F probably damaging Het
Hydin C T 8: 111,239,642 (GRCm39) T1974M possibly damaging Het
Ighv10-1 T A 12: 114,442,650 (GRCm39) T112S probably damaging Het
Ireb2 T A 9: 54,789,620 (GRCm39) V98E probably damaging Het
Irf4 A C 13: 30,937,435 (GRCm39) H167P probably benign Het
Irf6 C T 1: 192,845,021 (GRCm39) P164L probably benign Het
Josd1 A G 15: 79,561,451 (GRCm39) I119T probably damaging Het
Kcna5 G T 6: 126,512,011 (GRCm39) T39K probably damaging Het
Klhl24 A G 16: 19,941,750 (GRCm39) D566G probably damaging Het
Kmt2a T A 9: 44,761,154 (GRCm39) K232* probably null Het
Krt36 A G 11: 99,996,061 (GRCm39) L121P probably damaging Het
Lama3 A T 18: 12,595,864 (GRCm39) H931L probably benign Het
Lamp3 A T 16: 19,474,141 (GRCm39) I411N probably damaging Het
Lingo3 C T 10: 80,670,610 (GRCm39) W440* probably null Het
Mia2 T C 12: 59,236,433 (GRCm39) Y712H probably damaging Het
Mlh1 T A 9: 111,059,145 (GRCm39) probably null Het
Mta3 T A 17: 84,070,363 (GRCm39) S174T probably benign Het
Myo15a A G 11: 60,381,963 (GRCm39) T347A Het
Naaladl2 C T 3: 23,900,718 (GRCm39) R704H possibly damaging Het
Nfib T C 4: 82,246,030 (GRCm39) N394S probably benign Het
Nr2f2 A G 7: 70,009,681 (GRCm39) Y133H probably damaging Het
Or2ak7 C T 11: 58,575,500 (GRCm39) S267F possibly damaging Het
Or2i1 C T 17: 37,508,047 (GRCm39) E196K probably damaging Het
Or4c115 A G 2: 88,927,932 (GRCm39) V113A possibly damaging Het
Or4f61 A T 2: 111,922,822 (GRCm39) C75S probably benign Het
Or5p62 T A 7: 107,771,391 (GRCm39) M187L probably benign Het
Phgdh C A 3: 98,247,124 (GRCm39) V9L probably damaging Het
Pkd2 T A 5: 104,628,103 (GRCm39) D392E probably damaging Het
Plekhm3 A G 1: 64,960,874 (GRCm39) S461P probably benign Het
Prss39 A G 1: 34,539,308 (GRCm39) T183A probably benign Het
Pter T A 2: 12,999,566 (GRCm39) I235K probably damaging Het
Ptp4a3 T C 15: 73,628,756 (GRCm39) V172A probably benign Het
Rasa2 T C 9: 96,484,780 (GRCm39) N145D probably benign Het
Rasal2 A T 1: 157,071,218 (GRCm39) H45Q probably benign Het
Rbm43 A G 2: 51,815,909 (GRCm39) V104A probably damaging Het
Rhbdd2 C A 5: 135,667,969 (GRCm39) probably null Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Rimbp2 T A 5: 128,838,528 (GRCm39) N1023I probably damaging Het
Rtl1 A T 12: 109,561,031 (GRCm39) D269E possibly damaging Het
Sbp A G 17: 24,161,163 (GRCm39) probably benign Het
Sorbs1 T A 19: 40,316,020 (GRCm39) T374S probably benign Het
Tgs1 A T 4: 3,598,652 (GRCm39) K655I probably benign Het
Thsd1 A C 8: 22,749,585 (GRCm39) T819P probably damaging Het
Tmprss11c C T 5: 86,379,655 (GRCm39) V418M probably damaging Het
Top2a A T 11: 98,900,431 (GRCm39) D645E probably damaging Het
Top2b G A 14: 16,413,081 (GRCm38) V997I possibly damaging Het
Ttc34 A G 4: 154,943,840 (GRCm39) D118G probably damaging Het
Ttll5 A G 12: 85,935,948 (GRCm39) D353G probably damaging Het
Uba6 A T 5: 86,265,924 (GRCm39) Y994* probably null Het
Vinac1 A C 2: 128,879,049 (GRCm39) V959G unknown Het
Vmn1r189 A T 13: 22,285,906 (GRCm39) Y310* probably null Het
Vps13c T A 9: 67,834,265 (GRCm39) I1644N probably damaging Het
Zfp811 T C 17: 33,017,821 (GRCm39) D73G possibly damaging Het
Zfp951 A T 5: 104,962,838 (GRCm39) C243S probably benign Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102,208,248 (GRCm39) missense probably damaging 1.00
IGL00839:Espl1 APN 15 102,228,982 (GRCm39) unclassified probably benign
IGL00919:Espl1 APN 15 102,207,064 (GRCm39) missense probably benign 0.03
IGL01125:Espl1 APN 15 102,231,373 (GRCm39) missense probably damaging 1.00
IGL01366:Espl1 APN 15 102,228,271 (GRCm39) missense probably benign 0.00
IGL01488:Espl1 APN 15 102,207,174 (GRCm39) missense probably benign
IGL01554:Espl1 APN 15 102,221,660 (GRCm39) missense probably damaging 1.00
IGL01810:Espl1 APN 15 102,206,640 (GRCm39) missense probably benign
IGL01959:Espl1 APN 15 102,214,097 (GRCm39) splice site probably benign
IGL02267:Espl1 APN 15 102,224,099 (GRCm39) missense probably benign 0.01
IGL02452:Espl1 APN 15 102,208,274 (GRCm39) missense probably damaging 1.00
IGL02469:Espl1 APN 15 102,222,460 (GRCm39) missense probably damaging 1.00
IGL02500:Espl1 APN 15 102,224,235 (GRCm39) missense probably benign
IGL02630:Espl1 APN 15 102,205,253 (GRCm39) missense probably benign 0.11
IGL02687:Espl1 APN 15 102,221,613 (GRCm39) splice site probably benign
IGL02868:Espl1 APN 15 102,222,425 (GRCm39) nonsense probably null
IGL02926:Espl1 APN 15 102,208,290 (GRCm39) missense probably damaging 0.99
R0019:Espl1 UTSW 15 102,214,754 (GRCm39) missense probably null 0.01
R0129:Espl1 UTSW 15 102,225,083 (GRCm39) missense probably benign 0.00
R0184:Espl1 UTSW 15 102,207,651 (GRCm39) missense probably benign 0.01
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0267:Espl1 UTSW 15 102,221,452 (GRCm39) missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102,212,421 (GRCm39) nonsense probably null
R0587:Espl1 UTSW 15 102,212,382 (GRCm39) splice site probably benign
R0726:Espl1 UTSW 15 102,231,033 (GRCm39) missense probably benign
R1186:Espl1 UTSW 15 102,212,474 (GRCm39) missense probably benign 0.05
R1282:Espl1 UTSW 15 102,223,826 (GRCm39) missense probably benign 0.00
R1428:Espl1 UTSW 15 102,214,120 (GRCm39) missense probably benign 0.06
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1473:Espl1 UTSW 15 102,228,878 (GRCm39) missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102,206,802 (GRCm39) missense probably damaging 0.98
R1639:Espl1 UTSW 15 102,229,149 (GRCm39) missense probably damaging 1.00
R1725:Espl1 UTSW 15 102,221,656 (GRCm39) missense probably benign 0.08
R1748:Espl1 UTSW 15 102,206,964 (GRCm39) missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102,207,448 (GRCm39) missense probably benign
R1938:Espl1 UTSW 15 102,213,477 (GRCm39) missense probably benign 0.00
R1954:Espl1 UTSW 15 102,206,823 (GRCm39) missense probably damaging 1.00
R2009:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2014:Espl1 UTSW 15 102,231,149 (GRCm39) nonsense probably null
R2067:Espl1 UTSW 15 102,207,525 (GRCm39) missense probably damaging 0.96
R2084:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R2164:Espl1 UTSW 15 102,228,023 (GRCm39) missense probably damaging 1.00
R2204:Espl1 UTSW 15 102,214,340 (GRCm39) missense probably damaging 1.00
R2220:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2237:Espl1 UTSW 15 102,224,004 (GRCm39) missense probably damaging 0.98
R2314:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3107:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3108:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3114:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3616:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3733:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3958:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3959:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3960:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4062:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4063:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4064:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4165:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4166:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4349:Espl1 UTSW 15 102,228,039 (GRCm39) missense probably benign 0.26
R4373:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4376:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4377:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4516:Espl1 UTSW 15 102,231,671 (GRCm39) missense probably benign 0.00
R4595:Espl1 UTSW 15 102,207,159 (GRCm39) missense probably benign 0.01
R4884:Espl1 UTSW 15 102,232,505 (GRCm39) missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102,230,758 (GRCm39) critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102,223,676 (GRCm39) missense probably damaging 0.98
R4931:Espl1 UTSW 15 102,214,165 (GRCm39) missense probably benign 0.02
R4936:Espl1 UTSW 15 102,213,372 (GRCm39) missense probably damaging 1.00
R5000:Espl1 UTSW 15 102,206,986 (GRCm39) missense probably damaging 1.00
R5220:Espl1 UTSW 15 102,207,012 (GRCm39) missense probably benign 0.03
R5329:Espl1 UTSW 15 102,220,953 (GRCm39) missense probably damaging 0.97
R5501:Espl1 UTSW 15 102,225,565 (GRCm39) missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102,232,465 (GRCm39) missense probably damaging 1.00
R5848:Espl1 UTSW 15 102,231,011 (GRCm39) missense probably benign 0.03
R5906:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R5978:Espl1 UTSW 15 102,224,209 (GRCm39) missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102,208,323 (GRCm39) missense probably damaging 0.99
R6313:Espl1 UTSW 15 102,224,247 (GRCm39) missense probably benign 0.00
R6414:Espl1 UTSW 15 102,223,995 (GRCm39) missense probably damaging 0.96
R6484:Espl1 UTSW 15 102,231,935 (GRCm39) missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102,207,660 (GRCm39) missense probably benign
R6928:Espl1 UTSW 15 102,207,342 (GRCm39) missense probably benign 0.28
R6995:Espl1 UTSW 15 102,212,535 (GRCm39) missense possibly damaging 0.94
R7053:Espl1 UTSW 15 102,225,328 (GRCm39) critical splice donor site probably null
R7062:Espl1 UTSW 15 102,207,331 (GRCm39) missense probably benign 0.00
R7135:Espl1 UTSW 15 102,227,959 (GRCm39) nonsense probably null
R7154:Espl1 UTSW 15 102,232,484 (GRCm39) missense probably damaging 1.00
R7164:Espl1 UTSW 15 102,221,638 (GRCm39) missense probably damaging 1.00
R7522:Espl1 UTSW 15 102,213,486 (GRCm39) missense probably damaging 1.00
R7848:Espl1 UTSW 15 102,224,961 (GRCm39) missense probably damaging 1.00
R8275:Espl1 UTSW 15 102,211,188 (GRCm39) splice site probably benign
R8752:Espl1 UTSW 15 102,214,759 (GRCm39) missense probably damaging 1.00
R9160:Espl1 UTSW 15 102,206,953 (GRCm39) missense probably damaging 1.00
R9310:Espl1 UTSW 15 102,205,285 (GRCm39) critical splice donor site probably null
R9385:Espl1 UTSW 15 102,207,185 (GRCm39) missense probably damaging 0.99
R9532:Espl1 UTSW 15 102,228,260 (GRCm39) nonsense probably null
R9563:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9565:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9723:Espl1 UTSW 15 102,229,170 (GRCm39) missense probably benign 0.43
X0062:Espl1 UTSW 15 102,206,832 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGTCCTTCAGCTTGTGG -3'
(R):5'- TGCTTCTGACCACTGTGTGC -3'

Sequencing Primer
(F):5'- AGCCTAGTTCTCAGGAATTATTGAG -3'
(R):5'- GCCTTTAATTCCAGCACTAGGAAGG -3'
Posted On 2019-12-20