Incidental Mutation 'R7894:Espl1'
ID609552
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Nameextra spindle pole bodies 1, separase
SynonymsSSE, ESP1, PRCE, Cerp, PRCE, separase
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7894 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location102296266-102324357 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 102304025 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 522 (V522G)
Ref Sequence ENSEMBL: ENSMUSP00000064465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]
Predicted Effect probably damaging
Transcript: ENSMUST00000064924
AA Change: V522G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: V522G

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229050
AA Change: V522G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,106,589 M1551T possibly damaging Het
Abcc9 A G 6: 142,594,007 *1547Q probably null Het
Adamts20 A C 15: 94,351,760 C459G probably damaging Het
Adamts5 C T 16: 85,877,920 W452* probably null Het
Adcy8 G T 15: 64,920,205 Q301K possibly damaging Het
Adgrv1 A C 13: 81,567,451 C873G probably benign Het
AI314180 T C 4: 58,853,708 N361S probably damaging Het
Ak9 A G 10: 41,420,539 D1427G unknown Het
Amy2a1 T A 3: 113,530,541 M117L possibly damaging Het
Ap5z1 G T 5: 142,466,284 R23L probably benign Het
Ap5z1 C T 5: 142,470,436 Q337* probably null Het
Astn1 C A 1: 158,601,938 Q759K probably damaging Het
Cd276 T A 9: 58,537,479 T70S possibly damaging Het
Cd38 C T 5: 43,900,404 T106I probably damaging Het
Cdon C G 9: 35,476,948 R740G probably damaging Het
Clk2 C T 3: 89,168,894 R124W possibly damaging Het
Cyp1b1 C T 17: 79,714,215 V33M possibly damaging Het
Dab1 T A 4: 104,732,138 D547E probably benign Het
Degs1 A T 1: 182,276,851 Y290N probably damaging Het
Degs1 G C 1: 182,276,852 H289Q probably benign Het
Dopey2 T A 16: 93,810,204 C2249S probably benign Het
Ehd4 A C 2: 120,102,428 Y172* probably null Het
Erc2 A G 14: 27,777,208 D347G probably damaging Het
Fabp9 T A 3: 10,197,167 T10S probably benign Het
Fam193a T C 5: 34,440,533 I558T possibly damaging Het
Fhod1 T C 8: 105,331,157 E912G probably damaging Het
Gja1 T C 10: 56,388,549 F335L possibly damaging Het
Gm14025 A C 2: 129,037,129 V959G unknown Het
Gm29106 A G 1: 118,199,535 H319R probably damaging Het
Hunk C T 16: 90,472,465 S299F probably damaging Het
Hydin C T 8: 110,513,010 T1974M possibly damaging Het
Ighv10-1 T A 12: 114,479,030 T112S probably damaging Het
Ireb2 T A 9: 54,882,336 V98E probably damaging Het
Irf4 A C 13: 30,753,452 H167P probably benign Het
Irf6 C T 1: 193,162,713 P164L probably benign Het
Josd1 A G 15: 79,677,250 I119T probably damaging Het
Kcna5 G T 6: 126,535,048 T39K probably damaging Het
Klhl24 A G 16: 20,123,000 D566G probably damaging Het
Kmt2a T A 9: 44,849,857 K232* probably null Het
Krt36 A G 11: 100,105,235 L121P probably damaging Het
Lama3 A T 18: 12,462,807 H931L probably benign Het
Lamp3 A T 16: 19,655,391 I411N probably damaging Het
Lingo3 C T 10: 80,834,776 W440* probably null Het
Mia2 T C 12: 59,189,647 Y712H probably damaging Het
Mlh1 T A 9: 111,230,077 probably null Het
Mta3 T A 17: 83,762,934 S174T probably benign Het
Myo15 A G 11: 60,491,137 T347A Het
Naaladl2 C T 3: 23,846,554 R704H possibly damaging Het
Nfib T C 4: 82,327,793 N394S probably benign Het
Nr2f2 A G 7: 70,359,933 Y133H probably damaging Het
Olfr1220 A G 2: 89,097,588 V113A possibly damaging Het
Olfr1314 A T 2: 112,092,477 C75S probably benign Het
Olfr320 C T 11: 58,684,674 S267F possibly damaging Het
Olfr486 T A 7: 108,172,184 M187L probably benign Het
Olfr94 C T 17: 37,197,156 E196K probably damaging Het
Phgdh C A 3: 98,339,808 V9L probably damaging Het
Pkd2 T A 5: 104,480,237 D392E probably damaging Het
Plekhm3 A G 1: 64,921,715 S461P probably benign Het
Prss39 A G 1: 34,500,227 T183A probably benign Het
Pter T A 2: 12,994,755 I235K probably damaging Het
Ptp4a3 T C 15: 73,756,907 V172A probably benign Het
Rasa2 T C 9: 96,602,727 N145D probably benign Het
Rasal2 A T 1: 157,243,648 H45Q probably benign Het
Rbm43 A G 2: 51,925,897 V104A probably damaging Het
Rhbdd2 C A 5: 135,639,115 probably null Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rimbp2 T A 5: 128,761,464 N1023I probably damaging Het
Rtl1 A T 12: 109,594,597 D269E possibly damaging Het
Sbp A G 17: 23,942,189 probably benign Het
Sorbs1 T A 19: 40,327,576 T374S probably benign Het
Tgs1 A T 4: 3,598,652 K655I probably benign Het
Thsd1 A C 8: 22,259,569 T819P probably damaging Het
Tmprss11c C T 5: 86,231,796 V418M probably damaging Het
Top2a A T 11: 99,009,605 D645E probably damaging Het
Top2b G A 14: 16,413,081 V997I possibly damaging Het
Ttc34 A G 4: 154,859,383 D118G probably damaging Het
Ttll5 A G 12: 85,889,174 D353G probably damaging Het
Uba6 A T 5: 86,118,065 Y994* probably null Het
Vmn1r189 A T 13: 22,101,736 Y310* probably null Het
Vps13c T A 9: 67,926,983 I1644N probably damaging Het
Zfp811 T C 17: 32,798,847 D73G possibly damaging Het
Zfp951 A T 5: 104,814,972 C243S probably benign Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102299813 missense probably damaging 1.00
IGL00839:Espl1 APN 15 102320547 unclassified probably benign
IGL00919:Espl1 APN 15 102298629 missense probably benign 0.03
IGL01125:Espl1 APN 15 102322938 missense probably damaging 1.00
IGL01366:Espl1 APN 15 102319836 missense probably benign 0.00
IGL01488:Espl1 APN 15 102298739 missense probably benign
IGL01554:Espl1 APN 15 102313225 missense probably damaging 1.00
IGL01810:Espl1 APN 15 102298205 missense probably benign
IGL01959:Espl1 APN 15 102305662 splice site probably benign
IGL02267:Espl1 APN 15 102315664 missense probably benign 0.01
IGL02452:Espl1 APN 15 102299839 missense probably damaging 1.00
IGL02469:Espl1 APN 15 102314025 missense probably damaging 1.00
IGL02500:Espl1 APN 15 102315800 missense probably benign
IGL02630:Espl1 APN 15 102296818 missense probably benign 0.11
IGL02687:Espl1 APN 15 102313178 splice site probably benign
IGL02868:Espl1 APN 15 102313990 nonsense probably null
IGL02926:Espl1 APN 15 102299855 missense probably damaging 0.99
R0019:Espl1 UTSW 15 102306319 missense probably null 0.01
R0129:Espl1 UTSW 15 102316648 missense probably benign 0.00
R0184:Espl1 UTSW 15 102299216 missense probably benign 0.01
R0240:Espl1 UTSW 15 102312541 missense probably benign 0.00
R0240:Espl1 UTSW 15 102312541 missense probably benign 0.00
R0267:Espl1 UTSW 15 102313017 missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102303986 nonsense probably null
R0587:Espl1 UTSW 15 102303947 splice site probably benign
R0726:Espl1 UTSW 15 102322598 missense probably benign
R1186:Espl1 UTSW 15 102304039 missense probably benign 0.05
R1282:Espl1 UTSW 15 102315391 missense probably benign 0.00
R1428:Espl1 UTSW 15 102305685 missense probably benign 0.06
R1467:Espl1 UTSW 15 102319858 missense probably benign 0.09
R1467:Espl1 UTSW 15 102319858 missense probably benign 0.09
R1473:Espl1 UTSW 15 102320443 missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102298367 missense probably damaging 0.98
R1639:Espl1 UTSW 15 102320714 missense probably damaging 1.00
R1725:Espl1 UTSW 15 102313221 missense probably benign 0.08
R1748:Espl1 UTSW 15 102298529 missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102299013 missense probably benign
R1938:Espl1 UTSW 15 102305042 missense probably benign 0.00
R1954:Espl1 UTSW 15 102298388 missense probably damaging 1.00
R2009:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R2014:Espl1 UTSW 15 102322714 nonsense probably null
R2067:Espl1 UTSW 15 102299090 missense probably damaging 0.96
R2084:Espl1 UTSW 15 102296851 critical splice donor site probably null
R2164:Espl1 UTSW 15 102319588 missense probably damaging 1.00
R2204:Espl1 UTSW 15 102305905 missense probably damaging 1.00
R2220:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R2237:Espl1 UTSW 15 102315569 missense probably damaging 0.98
R2314:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3107:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3108:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3114:Espl1 UTSW 15 102323204 missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102323204 missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3616:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3732:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3732:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3733:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3958:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3959:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3960:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4062:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4063:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4064:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4165:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4166:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4349:Espl1 UTSW 15 102319604 missense probably benign 0.26
R4373:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4376:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4377:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4516:Espl1 UTSW 15 102323236 missense probably benign 0.00
R4595:Espl1 UTSW 15 102298724 missense probably benign 0.01
R4884:Espl1 UTSW 15 102324070 missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102322323 critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102315241 missense probably damaging 0.98
R4931:Espl1 UTSW 15 102305730 missense probably benign 0.02
R4936:Espl1 UTSW 15 102304937 missense probably damaging 1.00
R5000:Espl1 UTSW 15 102298551 missense probably damaging 1.00
R5220:Espl1 UTSW 15 102298577 missense probably benign 0.03
R5329:Espl1 UTSW 15 102312518 missense probably damaging 0.97
R5501:Espl1 UTSW 15 102317130 missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102324030 missense probably damaging 1.00
R5848:Espl1 UTSW 15 102322576 missense probably benign 0.03
R5906:Espl1 UTSW 15 102296851 critical splice donor site probably null
R5978:Espl1 UTSW 15 102315774 missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102299888 missense probably damaging 0.99
R6313:Espl1 UTSW 15 102315812 missense probably benign 0.00
R6414:Espl1 UTSW 15 102315560 missense probably damaging 0.96
R6484:Espl1 UTSW 15 102323500 missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102299225 missense probably benign
R6928:Espl1 UTSW 15 102298907 missense probably benign 0.28
R6995:Espl1 UTSW 15 102304100 missense possibly damaging 0.94
R7053:Espl1 UTSW 15 102316893 critical splice donor site probably null
R7062:Espl1 UTSW 15 102298896 missense probably benign 0.00
R7135:Espl1 UTSW 15 102319524 nonsense probably null
R7154:Espl1 UTSW 15 102324049 missense probably damaging 1.00
R7164:Espl1 UTSW 15 102313203 missense probably damaging 1.00
R7522:Espl1 UTSW 15 102305051 missense probably damaging 1.00
R7848:Espl1 UTSW 15 102316526 missense probably damaging 1.00
X0062:Espl1 UTSW 15 102298397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGTCCTTCAGCTTGTGG -3'
(R):5'- TGCTTCTGACCACTGTGTGC -3'

Sequencing Primer
(F):5'- AGCCTAGTTCTCAGGAATTATTGAG -3'
(R):5'- GCCTTTAATTCCAGCACTAGGAAGG -3'
Posted On2019-12-20