Mutagenetix > Incidental Mutation

Incidental Mutation 'R7894:Espl1'

609552

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7894 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 102304025 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 522 (V522G)

Ref Sequence

ENSEMBL: ENSMUSP00000064465 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]

AlphaFold

P60330

Predicted Effect

probably damaging
Transcript: ENSMUST00000064924
AA Change: V522G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: V522G

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000229050
AA Change: V522G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

99% (81/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	G	11: 110,106,589	M1551T	possibly damaging	Het
Abcc9	A	G	6: 142,594,007	*1547Q	probably null	Het
Adamts20	A	C	15: 94,351,760	C459G	probably damaging	Het
Adamts5	C	T	16: 85,877,920	W452*	probably null	Het
Adcy8	G	T	15: 64,920,205	Q301K	possibly damaging	Het
Adgrv1	A	C	13: 81,567,451	C873G	probably benign	Het
AI314180	T	C	4: 58,853,708	N361S	probably damaging	Het
Ak9	A	G	10: 41,420,539	D1427G	unknown	Het
Amy2a1	T	A	3: 113,530,541	M117L	possibly damaging	Het
Ap5z1	G	T	5: 142,466,284	R23L	probably benign	Het
Ap5z1	C	T	5: 142,470,436	Q337*	probably null	Het
Astn1	C	A	1: 158,601,938	Q759K	probably damaging	Het
Cd276	T	A	9: 58,537,479	T70S	possibly damaging	Het
Cd38	C	T	5: 43,900,404	T106I	probably damaging	Het
Cdon	C	G	9: 35,476,948	R740G	probably damaging	Het
Clk2	C	T	3: 89,168,894	R124W	possibly damaging	Het
Cyp1b1	C	T	17: 79,714,215	V33M	possibly damaging	Het
Dab1	T	A	4: 104,732,138	D547E	probably benign	Het
Degs1	A	T	1: 182,276,851	Y290N	probably damaging	Het
Degs1	G	C	1: 182,276,852	H289Q	probably benign	Het
Dopey2	T	A	16: 93,810,204	C2249S	probably benign	Het
Ehd4	A	C	2: 120,102,428	Y172*	probably null	Het
Erc2	A	G	14: 27,777,208	D347G	probably damaging	Het
Fabp9	T	A	3: 10,197,167	T10S	probably benign	Het
Fam193a	T	C	5: 34,440,533	I558T	possibly damaging	Het
Fhod1	T	C	8: 105,331,157	E912G	probably damaging	Het
Gja1	T	C	10: 56,388,549	F335L	possibly damaging	Het
Gm14025	A	C	2: 129,037,129	V959G	unknown	Het
Gm29106	A	G	1: 118,199,535	H319R	probably damaging	Het
Hunk	C	T	16: 90,472,465	S299F	probably damaging	Het
Hydin	C	T	8: 110,513,010	T1974M	possibly damaging	Het
Ighv10-1	T	A	12: 114,479,030	T112S	probably damaging	Het
Ireb2	T	A	9: 54,882,336	V98E	probably damaging	Het
Irf4	A	C	13: 30,753,452	H167P	probably benign	Het
Irf6	C	T	1: 193,162,713	P164L	probably benign	Het
Josd1	A	G	15: 79,677,250	I119T	probably damaging	Het
Kcna5	G	T	6: 126,535,048	T39K	probably damaging	Het
Klhl24	A	G	16: 20,123,000	D566G	probably damaging	Het
Kmt2a	T	A	9: 44,849,857	K232*	probably null	Het
Krt36	A	G	11: 100,105,235	L121P	probably damaging	Het
Lama3	A	T	18: 12,462,807	H931L	probably benign	Het
Lamp3	A	T	16: 19,655,391	I411N	probably damaging	Het
Lingo3	C	T	10: 80,834,776	W440*	probably null	Het
Mia2	T	C	12: 59,189,647	Y712H	probably damaging	Het
Mlh1	T	A	9: 111,230,077		probably null	Het
Mta3	T	A	17: 83,762,934	S174T	probably benign	Het
Myo15	A	G	11: 60,491,137	T347A		Het
Naaladl2	C	T	3: 23,846,554	R704H	possibly damaging	Het
Nfib	T	C	4: 82,327,793	N394S	probably benign	Het
Nr2f2	A	G	7: 70,359,933	Y133H	probably damaging	Het
Olfr1220	A	G	2: 89,097,588	V113A	possibly damaging	Het
Olfr1314	A	T	2: 112,092,477	C75S	probably benign	Het
Olfr320	C	T	11: 58,684,674	S267F	possibly damaging	Het
Olfr486	T	A	7: 108,172,184	M187L	probably benign	Het
Olfr94	C	T	17: 37,197,156	E196K	probably damaging	Het
Phgdh	C	A	3: 98,339,808	V9L	probably damaging	Het
Pkd2	T	A	5: 104,480,237	D392E	probably damaging	Het
Plekhm3	A	G	1: 64,921,715	S461P	probably benign	Het
Prss39	A	G	1: 34,500,227	T183A	probably benign	Het
Pter	T	A	2: 12,994,755	I235K	probably damaging	Het
Ptp4a3	T	C	15: 73,756,907	V172A	probably benign	Het
Rasa2	T	C	9: 96,602,727	N145D	probably benign	Het
Rasal2	A	T	1: 157,243,648	H45Q	probably benign	Het
Rbm43	A	G	2: 51,925,897	V104A	probably damaging	Het
Rhbdd2	C	A	5: 135,639,115		probably null	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Rimbp2	T	A	5: 128,761,464	N1023I	probably damaging	Het
Rtl1	A	T	12: 109,594,597	D269E	possibly damaging	Het
Sbp	A	G	17: 23,942,189		probably benign	Het
Sorbs1	T	A	19: 40,327,576	T374S	probably benign	Het
Tgs1	A	T	4: 3,598,652	K655I	probably benign	Het
Thsd1	A	C	8: 22,259,569	T819P	probably damaging	Het
Tmprss11c	C	T	5: 86,231,796	V418M	probably damaging	Het
Top2a	A	T	11: 99,009,605	D645E	probably damaging	Het
Top2b	G	A	14: 16,413,081	V997I	possibly damaging	Het
Ttc34	A	G	4: 154,859,383	D118G	probably damaging	Het
Ttll5	A	G	12: 85,889,174	D353G	probably damaging	Het
Uba6	A	T	5: 86,118,065	Y994*	probably null	Het
Vmn1r189	A	T	13: 22,101,736	Y310*	probably null	Het
Vps13c	T	A	9: 67,926,983	I1644N	probably damaging	Het
Zfp811	T	C	17: 32,798,847	D73G	possibly damaging	Het
Zfp951	A	T	5: 104,814,972	C243S	probably benign	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGGTCCTTCAGCTTGTGG -3'
(R):5'- TGCTTCTGACCACTGTGTGC -3'

Sequencing Primer
(F):5'- AGCCTAGTTCTCAGGAATTATTGAG -3'
(R):5'- GCCTTTAATTCCAGCACTAGGAAGG -3'

Posted On

2019-12-20