Mutagenetix > Incidental Mutations

Incidental Mutation 'R7894:Adamts5'

609555

Institutional Source

Beutler Lab

Gene Symbol

Adamts5

Ensembl Gene

ENSMUSG00000022894

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)

Synonyms

9530092O11Rik, ADAM-TS5

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.254) question?

Stock #

R7894 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

85856173-85901828 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 85877920 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Stop codon at position 452 (W452*)

Ref Sequence

ENSEMBL: ENSMUSP00000023611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023611]

AlphaFold

Q9R001

Predicted Effect

probably null
Transcript: ENSMUST00000023611
AA Change: W452*

SMART Domains

Protein: ENSMUSP00000023611
Gene: ENSMUSG00000022894
AA Change: W452*

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Pep_M12B_propep	41	182	9.1e-18	PFAM
low complexity region	226	232	N/A	INTRINSIC
Pfam:Reprolysin_5	265	450	2.1e-16	PFAM
Pfam:Reprolysin_4	265	472	4.8e-14	PFAM
Pfam:Reprolysin	267	476	4.6e-26	PFAM
Pfam:Reprolysin_2	286	466	3.7e-13	PFAM
Pfam:Reprolysin_3	288	421	6.9e-17	PFAM
Blast:ACR	477	555	4e-15	BLAST
low complexity region	556	566	N/A	INTRINSIC
TSP1	570	622	6.04e-13	SMART
Pfam:ADAM_spacer1	732	852	1.7e-35	PFAM
TSP1	878	926	7.12e-2	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

99% (81/82)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. Mice lacking the encoded protein are protected from surgery-induced osteoarthritis and antigen-induced arthritis. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit a significant reduction in cartilage degradation after induction of osteoarthritis whereas those homozygous for another show no affect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	G	11: 110,106,589	M1551T	possibly damaging	Het
Abcc9	A	G	6: 142,594,007	*1547Q	probably null	Het
Adamts20	A	C	15: 94,351,760	C459G	probably damaging	Het
Adcy8	G	T	15: 64,920,205	Q301K	possibly damaging	Het
Adgrv1	A	C	13: 81,567,451	C873G	probably benign	Het
AI314180	T	C	4: 58,853,708	N361S	probably damaging	Het
Ak9	A	G	10: 41,420,539	D1427G	unknown	Het
Amy2a1	T	A	3: 113,530,541	M117L	possibly damaging	Het
Ap5z1	C	T	5: 142,470,436	Q337*	probably null	Het
Ap5z1	G	T	5: 142,466,284	R23L	probably benign	Het
Astn1	C	A	1: 158,601,938	Q759K	probably damaging	Het
Cd276	T	A	9: 58,537,479	T70S	possibly damaging	Het
Cd38	C	T	5: 43,900,404	T106I	probably damaging	Het
Cdon	C	G	9: 35,476,948	R740G	probably damaging	Het
Clk2	C	T	3: 89,168,894	R124W	possibly damaging	Het
Cyp1b1	C	T	17: 79,714,215	V33M	possibly damaging	Het
Dab1	T	A	4: 104,732,138	D547E	probably benign	Het
Degs1	A	T	1: 182,276,851	Y290N	probably damaging	Het
Degs1	G	C	1: 182,276,852	H289Q	probably benign	Het
Dopey2	T	A	16: 93,810,204	C2249S	probably benign	Het
Ehd4	A	C	2: 120,102,428	Y172*	probably null	Het
Erc2	A	G	14: 27,777,208	D347G	probably damaging	Het
Espl1	T	G	15: 102,304,025	V522G	probably damaging	Het
Fabp9	T	A	3: 10,197,167	T10S	probably benign	Het
Fam193a	T	C	5: 34,440,533	I558T	possibly damaging	Het
Fhod1	T	C	8: 105,331,157	E912G	probably damaging	Het
Gja1	T	C	10: 56,388,549	F335L	possibly damaging	Het
Gm14025	A	C	2: 129,037,129	V959G	unknown	Het
Gm29106	A	G	1: 118,199,535	H319R	probably damaging	Het
Hunk	C	T	16: 90,472,465	S299F	probably damaging	Het
Hydin	C	T	8: 110,513,010	T1974M	possibly damaging	Het
Ighv10-1	T	A	12: 114,479,030	T112S	probably damaging	Het
Ireb2	T	A	9: 54,882,336	V98E	probably damaging	Het
Irf4	A	C	13: 30,753,452	H167P	probably benign	Het
Irf6	C	T	1: 193,162,713	P164L	probably benign	Het
Josd1	A	G	15: 79,677,250	I119T	probably damaging	Het
Kcna5	G	T	6: 126,535,048	T39K	probably damaging	Het
Klhl24	A	G	16: 20,123,000	D566G	probably damaging	Het
Kmt2a	T	A	9: 44,849,857	K232*	probably null	Het
Krt36	A	G	11: 100,105,235	L121P	probably damaging	Het
Lama3	A	T	18: 12,462,807	H931L	probably benign	Het
Lamp3	A	T	16: 19,655,391	I411N	probably damaging	Het
Lingo3	C	T	10: 80,834,776	W440*	probably null	Het
Mia2	T	C	12: 59,189,647	Y712H	probably damaging	Het
Mlh1	T	A	9: 111,230,077		probably null	Het
Mta3	T	A	17: 83,762,934	S174T	probably benign	Het
Myo15	A	G	11: 60,491,137	T347A		Het
Naaladl2	C	T	3: 23,846,554	R704H	possibly damaging	Het
Nfib	T	C	4: 82,327,793	N394S	probably benign	Het
Nr2f2	A	G	7: 70,359,933	Y133H	probably damaging	Het
Olfr1220	A	G	2: 89,097,588	V113A	possibly damaging	Het
Olfr1314	A	T	2: 112,092,477	C75S	probably benign	Het
Olfr320	C	T	11: 58,684,674	S267F	possibly damaging	Het
Olfr486	T	A	7: 108,172,184	M187L	probably benign	Het
Olfr94	C	T	17: 37,197,156	E196K	probably damaging	Het
Phgdh	C	A	3: 98,339,808	V9L	probably damaging	Het
Pkd2	T	A	5: 104,480,237	D392E	probably damaging	Het
Plekhm3	A	G	1: 64,921,715	S461P	probably benign	Het
Prss39	A	G	1: 34,500,227	T183A	probably benign	Het
Pter	T	A	2: 12,994,755	I235K	probably damaging	Het
Ptp4a3	T	C	15: 73,756,907	V172A	probably benign	Het
Rasa2	T	C	9: 96,602,727	N145D	probably benign	Het
Rasal2	A	T	1: 157,243,648	H45Q	probably benign	Het
Rbm43	A	G	2: 51,925,897	V104A	probably damaging	Het
Rhbdd2	C	A	5: 135,639,115		probably null	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Rimbp2	T	A	5: 128,761,464	N1023I	probably damaging	Het
Rtl1	A	T	12: 109,594,597	D269E	possibly damaging	Het
Sbp	A	G	17: 23,942,189		probably benign	Het
Sorbs1	T	A	19: 40,327,576	T374S	probably benign	Het
Tgs1	A	T	4: 3,598,652	K655I	probably benign	Het
Thsd1	A	C	8: 22,259,569	T819P	probably damaging	Het
Tmprss11c	C	T	5: 86,231,796	V418M	probably damaging	Het
Top2a	A	T	11: 99,009,605	D645E	probably damaging	Het
Top2b	G	A	14: 16,413,081	V997I	possibly damaging	Het
Ttc34	A	G	4: 154,859,383	D118G	probably damaging	Het
Ttll5	A	G	12: 85,889,174	D353G	probably damaging	Het
Uba6	A	T	5: 86,118,065	Y994*	probably null	Het
Vmn1r189	A	T	13: 22,101,736	Y310*	probably null	Het
Vps13c	T	A	9: 67,926,983	I1644N	probably damaging	Het
Zfp811	T	C	17: 32,798,847	D73G	possibly damaging	Het
Zfp951	A	T	5: 104,814,972	C243S	probably benign	Het

Other mutations in Adamts5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01063:Adamts5	APN	16	85899834	missense	probably damaging	1.00
IGL01070:Adamts5	APN	16	85863133	missense	probably damaging	1.00
IGL01321:Adamts5	APN	16	85899475	missense	probably benign	0.03
IGL01616:Adamts5	APN	16	85887814	splice site	probably null
IGL02551:Adamts5	APN	16	85870038	missense	possibly damaging	0.71
IGL03263:Adamts5	APN	16	85869942	missense	probably damaging	0.99
IGL03295:Adamts5	APN	16	85877945	missense	probably damaging	1.00
IGL03393:Adamts5	APN	16	85868195	missense	probably damaging	0.99
IGL03403:Adamts5	APN	16	85863014	missense	probably damaging	0.97
R0414:Adamts5	UTSW	16	85877906	missense	probably damaging	1.00
R0419:Adamts5	UTSW	16	85866642	missense	probably benign	0.00
R0539:Adamts5	UTSW	16	85868692	missense	probably damaging	1.00
R0570:Adamts5	UTSW	16	85899247	missense	probably damaging	1.00
R0574:Adamts5	UTSW	16	85899484	missense	probably damaging	0.99
R0669:Adamts5	UTSW	16	85899726	missense	probably benign	0.45
R1454:Adamts5	UTSW	16	85869993	missense	possibly damaging	0.88
R1498:Adamts5	UTSW	16	85900102	missense	possibly damaging	0.63
R1729:Adamts5	UTSW	16	85877915	nonsense	probably null
R1753:Adamts5	UTSW	16	85899352	missense	probably damaging	1.00
R1784:Adamts5	UTSW	16	85877915	nonsense	probably null
R1906:Adamts5	UTSW	16	85868685	nonsense	probably null
R1946:Adamts5	UTSW	16	85899243	missense	probably damaging	1.00
R2180:Adamts5	UTSW	16	85887924	missense	probably damaging	1.00
R2223:Adamts5	UTSW	16	85899306	missense	probably damaging	1.00
R2366:Adamts5	UTSW	16	85862758	missense	probably damaging	1.00
R3889:Adamts5	UTSW	16	85868121	missense	probably damaging	1.00
R4214:Adamts5	UTSW	16	85868643	missense	probably damaging	1.00
R4909:Adamts5	UTSW	16	85900066	nonsense	probably null
R5119:Adamts5	UTSW	16	85899578	missense	probably benign	0.00
R5230:Adamts5	UTSW	16	85870068	missense	probably damaging	0.97
R5452:Adamts5	UTSW	16	85869912	critical splice donor site	probably benign
R5652:Adamts5	UTSW	16	85899268	missense	probably damaging	1.00
R5831:Adamts5	UTSW	16	85868118	missense	probably damaging	1.00
R6045:Adamts5	UTSW	16	85899300	missense	probably damaging	0.99
R6259:Adamts5	UTSW	16	85899753	missense	probably benign	0.03
R6384:Adamts5	UTSW	16	85862828	missense	probably benign	0.00
R6724:Adamts5	UTSW	16	85868557	missense	probably benign	0.06
R6829:Adamts5	UTSW	16	85870071	missense	possibly damaging	0.52
R7066:Adamts5	UTSW	16	85862764	missense	probably damaging	1.00
R7256:Adamts5	UTSW	16	85863035	missense	probably damaging	1.00
R7293:Adamts5	UTSW	16	85899945	missense	probably benign	0.10
R7298:Adamts5	UTSW	16	85899918	missense	probably benign	0.35
R7384:Adamts5	UTSW	16	85899826	missense	probably benign	0.02
R7452:Adamts5	UTSW	16	85877981	missense	probably benign	0.00
R7727:Adamts5	UTSW	16	85899966	missense	probably damaging	1.00
R7785:Adamts5	UTSW	16	85863004	missense	probably damaging	0.99
R8111:Adamts5	UTSW	16	85899315	missense	probably damaging	1.00
R8370:Adamts5	UTSW	16	85899993	missense	possibly damaging	0.74
R8413:Adamts5	UTSW	16	85866618	critical splice donor site	probably null
R8505:Adamts5	UTSW	16	85900056	missense	probably benign	0.42
R8804:Adamts5	UTSW	16	85869912	critical splice donor site	probably benign
R9209:Adamts5	UTSW	16	85870083	missense	probably damaging	1.00
X0062:Adamts5	UTSW	16	85863157	missense	probably damaging	1.00
Z1177:Adamts5	UTSW	16	85870074	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGGAGACTCTTCCAATAACCATTG -3'
(R):5'- GCAGCTTTCATATGCAGGGG -3'

Sequencing Primer
(F):5'- AACCATTGTCTCACAGGGTG -3'
(R):5'- CTCCTCTAGGGCATCTACTT -3'

Posted On

2019-12-20