Incidental Mutation 'R0681:Zbtb5'
ID60957
Institutional Source Beutler Lab
Gene Symbol Zbtb5
Ensembl Gene ENSMUSG00000049657
Gene Namezinc finger and BTB domain containing 5
Synonyms
MMRRC Submission 038866-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0681 (G1)
Quality Score95
Status Validated
Chromosome4
Chromosomal Location44991242-45012412 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44993787 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 532 (I532M)
Ref Sequence ENSEMBL: ENSMUSP00000136507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045078] [ENSMUST00000055028] [ENSMUST00000107817] [ENSMUST00000131991] [ENSMUST00000151148] [ENSMUST00000180217]
Predicted Effect probably benign
Transcript: ENSMUST00000045078
SMART Domains Protein: ENSMUSP00000047218
Gene: ENSMUSG00000035637

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 9 327 1.4e-28 PFAM
Pfam:2-Hacid_dh_C 116 295 1.3e-59 PFAM
Pfam:NAD_binding_2 153 272 3.4e-8 PFAM
Pfam:F420_oxidored 155 244 3.2e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000055028
AA Change: I532M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000059919
Gene: ENSMUSG00000049657
AA Change: I532M

DomainStartEndE-ValueType
BTB 24 123 1.06e-28 SMART
low complexity region 149 163 N/A INTRINSIC
low complexity region 345 361 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
low complexity region 444 459 N/A INTRINSIC
low complexity region 544 554 N/A INTRINSIC
ZnF_C2H2 606 628 1.16e-1 SMART
ZnF_C2H2 634 654 2.47e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107817
AA Change: I532M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103447
Gene: ENSMUSG00000049657
AA Change: I532M

DomainStartEndE-ValueType
BTB 24 123 1.06e-28 SMART
low complexity region 149 163 N/A INTRINSIC
low complexity region 345 361 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
low complexity region 444 459 N/A INTRINSIC
low complexity region 544 554 N/A INTRINSIC
ZnF_C2H2 606 628 1.16e-1 SMART
ZnF_C2H2 634 654 2.47e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131991
SMART Domains Protein: ENSMUSP00000122991
Gene: ENSMUSG00000049657

DomainStartEndE-ValueType
BTB 24 123 1.06e-28 SMART
low complexity region 149 163 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151148
SMART Domains Protein: ENSMUSP00000120254
Gene: ENSMUSG00000035637

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 10 207 4.5e-15 PFAM
Pfam:2-Hacid_dh_C 63 222 2.2e-51 PFAM
Pfam:NAD_binding_2 100 219 3.3e-9 PFAM
Pfam:F420_oxidored 102 191 5.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180217
AA Change: I532M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136507
Gene: ENSMUSG00000049657
AA Change: I532M

DomainStartEndE-ValueType
BTB 24 123 1.06e-28 SMART
low complexity region 149 163 N/A INTRINSIC
low complexity region 345 361 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
low complexity region 444 459 N/A INTRINSIC
low complexity region 544 554 N/A INTRINSIC
ZnF_C2H2 606 628 1.16e-1 SMART
ZnF_C2H2 634 654 2.47e1 SMART
Meta Mutation Damage Score 0.3760 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 G T 8: 83,934,650 probably benign Het
Adgrv1 C A 13: 81,528,530 D1341Y probably damaging Het
Ahdc1 T C 4: 133,065,516 F1356S possibly damaging Het
BC027072 T G 17: 71,749,514 H1056P probably benign Het
Cdk13 A G 13: 17,721,297 probably benign Het
Cfhr1 A T 1: 139,557,511 S66T probably damaging Het
Cldn6 C A 17: 23,681,193 Q44K probably damaging Het
Cntnap5c T C 17: 58,305,555 V863A possibly damaging Het
Col6a4 T A 9: 106,067,144 K1044* probably null Het
Cyb561d1 A G 3: 108,199,267 V212A probably benign Het
Cyp1b1 A G 17: 79,713,846 S156P probably damaging Het
Dock7 G A 4: 99,016,704 H645Y probably damaging Het
Dpp3 T C 19: 4,914,654 N542D probably damaging Het
Fastkd3 C T 13: 68,591,928 probably benign Het
Galnt10 T A 11: 57,769,540 V268D probably damaging Het
Gm13078 A T 4: 143,728,052 T307S probably benign Het
Grb14 G T 2: 64,917,287 A10E probably damaging Het
Grin2c A G 11: 115,249,653 V1213A probably benign Het
Grip1 C T 10: 120,010,230 T570I probably damaging Het
Hif1an T C 19: 44,563,323 Y71H probably benign Het
Hsd17b11 T A 5: 104,003,206 I221L probably benign Het
Htra1 A T 7: 130,979,297 probably benign Het
Igfn1 T C 1: 135,963,853 E2308G possibly damaging Het
Mapk9 T A 11: 49,869,245 S129T probably damaging Het
Med22 T C 2: 26,910,379 T13A probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mtus1 A T 8: 40,993,517 L489Q probably damaging Het
Naprt G A 15: 75,893,632 P120S probably damaging Het
Nwd1 C T 8: 72,662,337 P172L probably damaging Het
Ogfod2 A G 5: 124,112,844 E62G probably null Het
Olfr1445 T C 19: 12,884,079 L66P probably damaging Het
Olfr1445 A G 19: 12,884,546 T222A probably damaging Het
Olfr211 A T 6: 116,494,400 S264C probably damaging Het
Palm A C 10: 79,819,493 T362P probably benign Het
Pcdh8 T C 14: 79,769,960 T388A probably benign Het
Pclo A G 5: 14,675,318 I1397V unknown Het
Per1 A G 11: 69,101,201 E127G probably damaging Het
Plekha1 T C 7: 130,900,623 V30A possibly damaging Het
Rab26 A G 17: 24,527,966 probably benign Het
Rasal2 T C 1: 157,157,180 D999G possibly damaging Het
Rfx5 C T 3: 94,956,355 T105I probably damaging Het
Rrp1b T C 17: 32,060,395 S677P probably damaging Het
Scaf4 G A 16: 90,249,694 P485S unknown Het
Scn5a A T 9: 119,539,640 M273K probably damaging Het
Sec22a C T 16: 35,361,556 probably null Het
Slc10a6 C A 5: 103,612,449 V227F possibly damaging Het
Slc39a3 C G 10: 81,033,731 E31Q probably benign Het
Spsb1 C T 4: 149,906,917 V65I probably benign Het
Tdrd7 T A 4: 46,016,879 M673K probably benign Het
Trim8 C A 19: 46,515,093 S361R possibly damaging Het
Ucp1 T A 8: 83,295,307 M256K possibly damaging Het
Vmn1r46 A T 6: 89,976,964 D265V probably damaging Het
Other mutations in Zbtb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01995:Zbtb5 APN 4 44995294 missense probably damaging 1.00
IGL02516:Zbtb5 APN 4 44993798 missense probably damaging 0.96
IGL02525:Zbtb5 APN 4 44994731 missense probably benign
IGL03172:Zbtb5 APN 4 44994003 missense possibly damaging 0.76
IGL03205:Zbtb5 APN 4 44994949 missense probably damaging 0.96
madeleine UTSW 4 44994863 unclassified probably null
R1426:Zbtb5 UTSW 4 44993968 missense possibly damaging 0.95
R1577:Zbtb5 UTSW 4 44995129 missense probably damaging 1.00
R1608:Zbtb5 UTSW 4 44993500 missense probably damaging 1.00
R1817:Zbtb5 UTSW 4 44993767 missense probably benign 0.20
R2919:Zbtb5 UTSW 4 44994790 missense probably damaging 1.00
R3722:Zbtb5 UTSW 4 44994863 unclassified probably null
R4222:Zbtb5 UTSW 4 44993855 unclassified probably null
R5217:Zbtb5 UTSW 4 44993990 missense probably benign
R5326:Zbtb5 UTSW 4 44995052 missense probably damaging 1.00
R5493:Zbtb5 UTSW 4 44993941 missense probably benign 0.04
R5542:Zbtb5 UTSW 4 44995052 missense probably damaging 1.00
R5912:Zbtb5 UTSW 4 44993750 missense probably benign 0.00
R6171:Zbtb5 UTSW 4 44994119 missense probably benign 0.00
R6337:Zbtb5 UTSW 4 44993459 missense probably damaging 1.00
R6566:Zbtb5 UTSW 4 44994508 missense probably damaging 1.00
R7481:Zbtb5 UTSW 4 44994905 missense probably benign 0.27
R7534:Zbtb5 UTSW 4 44995030 missense probably damaging 1.00
R7548:Zbtb5 UTSW 4 44994724 missense probably benign 0.18
R7557:Zbtb5 UTSW 4 44995196 missense probably damaging 1.00
R7584:Zbtb5 UTSW 4 44993678 missense probably benign
R7831:Zbtb5 UTSW 4 44995244 missense probably damaging 1.00
R7914:Zbtb5 UTSW 4 44995244 missense probably damaging 1.00
R8065:Zbtb5 UTSW 4 44994972 missense probably benign 0.25
R8067:Zbtb5 UTSW 4 44994972 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- ACCAAGACATTGTGCTCCGATAAGG -3'
(R):5'- GTTCCCATGTAGAGAACCCGTTCAG -3'

Sequencing Primer
(F):5'- GGCCTTCTTGCACTTTGAC -3'
(R):5'- ACTTCGTCAGACCTATGCAGG -3'
Posted On2013-07-30