Incidental Mutation 'R7895:Cfap65'
ID 609570
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
MMRRC Submission 045947-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.677) question?
Stock # R7895 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 74941230-74974758 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 74972321 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 13 (T13S)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect probably benign
Transcript: ENSMUST00000094844
AA Change: T13S

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: T13S

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (92/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,106,295 (GRCm39) S143T probably benign Het
9030624G23Rik A T 12: 24,094,724 (GRCm39) M149K unknown Het
Aadacl4fm4 A T 4: 144,396,913 (GRCm39) I273K possibly damaging Het
Agpat3 T A 10: 78,119,034 (GRCm39) I187F probably benign Het
Ahcyl1 C T 3: 107,576,467 (GRCm39) A332T probably damaging Het
Aldh3b3 A G 19: 4,014,871 (GRCm39) I123V possibly damaging Het
Ap5z1 T A 5: 142,456,313 (GRCm39) probably null Het
Apob A T 12: 8,061,933 (GRCm39) I3472F probably benign Het
Arhgef33 C T 17: 80,680,914 (GRCm39) P685S probably benign Het
Arhgef4 T C 1: 34,845,478 (GRCm39) I130T probably damaging Het
Arnt2 A T 7: 83,954,406 (GRCm39) F263I probably benign Het
Bbof1 A G 12: 84,466,763 (GRCm39) R177G probably damaging Het
Bbs2 C A 8: 94,807,764 (GRCm39) G372W probably damaging Het
Blmh T A 11: 76,836,721 (GRCm39) probably null Het
Ccdc30 A T 4: 119,209,910 (GRCm39) probably null Het
Cdca7l G T 12: 117,837,467 (GRCm39) L219F probably damaging Het
Cenpu C A 8: 47,015,499 (GRCm39) A138E probably benign Het
Clasp2 A G 9: 113,733,016 (GRCm39) M951V probably benign Het
Clca4a A G 3: 144,674,166 (GRCm39) S190P probably benign Het
Clcn4 A G 7: 7,298,167 (GRCm39) V74A probably benign Het
Cntln C T 4: 84,981,561 (GRCm39) T913M possibly damaging Het
Cntnap4 T A 8: 113,478,829 (GRCm39) V185E probably damaging Het
Col26a1 C T 5: 136,777,031 (GRCm39) probably null Het
Ctcf A T 8: 106,390,690 (GRCm39) Q99L possibly damaging Het
Dgke T C 11: 88,931,682 (GRCm39) Q524R probably damaging Het
Dhrs7 A T 12: 72,699,234 (GRCm39) probably null Het
Dnah7b T C 1: 46,289,110 (GRCm39) Y2969H probably damaging Het
Dync1h1 T G 12: 110,582,891 (GRCm39) I358S probably damaging Het
Efcab3 A C 11: 105,008,150 (GRCm39) D410A probably benign Het
Emilin2 T C 17: 71,580,908 (GRCm39) D606G probably benign Het
Ermard C T 17: 15,283,875 (GRCm39) T622I possibly damaging Het
Exo1 A G 1: 175,728,562 (GRCm39) D542G probably benign Het
Fgd5 A T 6: 91,964,262 (GRCm39) D165V probably benign Het
Gdap1 T C 1: 17,231,368 (GRCm39) W238R probably damaging Het
Gm11096 T G 17: 81,749,328 (GRCm39) I7M unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,450 (GRCm39) probably benign Het
Gmppb A T 9: 107,927,770 (GRCm39) M175L probably benign Het
Gorasp2 G A 2: 70,514,442 (GRCm39) S273N probably benign Het
Gtf3c1 T C 7: 125,271,994 (GRCm39) M642V possibly damaging Het
Hmx2 T A 7: 131,157,600 (GRCm39) L238Q probably damaging Het
Kif13b A G 14: 64,973,598 (GRCm39) D316G probably damaging Het
Kmt2c A G 5: 25,578,174 (GRCm39) S701P possibly damaging Het
Lama4 T A 10: 38,964,325 (GRCm39) N1332K probably damaging Het
Lrp2 T C 2: 69,288,823 (GRCm39) D3681G probably damaging Het
Maml3 G T 3: 51,605,143 (GRCm39) P722Q probably damaging Het
Mier2 C A 10: 79,377,719 (GRCm39) probably benign Het
Ms4a15 A T 19: 10,956,694 (GRCm39) probably null Het
Msh5 T C 17: 35,263,355 (GRCm39) M158V probably benign Het
Nova2 A T 7: 18,676,270 (GRCm39) K136I Het
Npm1 A T 11: 33,106,001 (GRCm39) probably null Het
Nr4a3 T A 4: 48,051,390 (GRCm39) M48K probably benign Het
Nrap T G 19: 56,342,584 (GRCm39) T806P probably benign Het
Ntf3 G A 6: 126,079,203 (GRCm39) T101M probably benign Het
Or2aj4 G A 16: 19,385,472 (GRCm39) R54* probably null Het
Paxbp1 T A 16: 90,822,166 (GRCm39) D648V probably damaging Het
Pcdhb18 T A 18: 37,623,520 (GRCm39) D283E probably benign Het
Phrf1 C A 7: 140,839,288 (GRCm39) Q828K unknown Het
Pigq A T 17: 26,156,299 (GRCm39) I43N probably benign Het
Pou6f2 G T 13: 18,300,033 (GRCm39) T542K Het
Ppfibp2 T A 7: 107,320,524 (GRCm39) probably null Het
Rab1b A T 19: 5,150,524 (GRCm39) M163K probably benign Het
Ralgapa1 A G 12: 55,793,934 (GRCm39) M567T probably benign Het
Reck T C 4: 43,890,970 (GRCm39) V36A probably benign Het
Resp18 C T 1: 75,254,846 (GRCm39) D36N probably null Het
Rint1 A C 5: 24,005,720 (GRCm39) H134P probably damaging Het
Rps19 A T 7: 24,587,764 (GRCm39) K77M possibly damaging Het
Sec24b A T 3: 129,789,598 (GRCm39) S808T probably benign Het
Sema4c A C 1: 36,592,199 (GRCm39) V216G probably damaging Het
Septin10 T A 10: 59,016,871 (GRCm39) T218S probably benign Het
Septin3 A T 15: 82,170,020 (GRCm39) H182L probably benign Het
Sipa1 A G 19: 5,702,690 (GRCm39) S836P probably benign Het
Slc9a5 A G 8: 106,089,998 (GRCm39) K652R probably damaging Het
Slco5a1 T A 1: 13,059,927 (GRCm39) I265F possibly damaging Het
Snapc5 T A 9: 64,086,614 (GRCm39) M1K probably null Het
Snx5 T A 2: 144,095,740 (GRCm39) D307V possibly damaging Het
Srebf2 A T 15: 82,061,441 (GRCm39) M381L probably benign Het
Ssh2 G C 11: 77,345,452 (GRCm39) E1146Q probably benign Het
Suco A T 1: 161,672,937 (GRCm39) probably null Het
Tanc2 T A 11: 105,812,651 (GRCm39) L1365Q probably damaging Het
Tas1r3 A G 4: 155,947,005 (GRCm39) L200P probably damaging Het
Thbs2 T G 17: 14,896,483 (GRCm39) D802A probably damaging Het
Trav3-1 G A 14: 52,818,550 (GRCm39) V75M probably benign Het
Trim9 G A 12: 70,301,961 (GRCm39) P559L probably benign Het
Trpc6 G A 9: 8,655,219 (GRCm39) G683D probably damaging Het
Unc5b C A 10: 60,615,509 (GRCm39) V164L possibly damaging Het
Usf3 A T 16: 44,036,565 (GRCm39) R348S possibly damaging Het
Vmn1r236 T C 17: 21,507,728 (GRCm39) V282A possibly damaging Het
Vmn2r1 A G 3: 63,997,130 (GRCm39) E262G possibly damaging Het
Xirp2 A G 2: 67,339,841 (GRCm39) E694G probably damaging Het
Xpo4 T A 14: 57,840,048 (GRCm39) H572L probably benign Het
Zfhx4 A G 3: 5,307,259 (GRCm39) T162A probably benign Het
Zfp110 T A 7: 12,571,020 (GRCm39) H59Q possibly damaging Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74,958,342 (GRCm39) critical splice donor site probably null
IGL01526:Cfap65 APN 1 74,950,237 (GRCm39) missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74,966,353 (GRCm39) missense probably benign
IGL01780:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL01993:Cfap65 APN 1 74,959,702 (GRCm39) missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74,967,304 (GRCm39) missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02357:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02576:Cfap65 APN 1 74,942,617 (GRCm39) missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74,944,239 (GRCm39) missense probably benign 0.00
IGL02792:Cfap65 APN 1 74,966,337 (GRCm39) missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74,950,267 (GRCm39) nonsense probably null
IGL03101:Cfap65 APN 1 74,967,592 (GRCm39) missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74,966,778 (GRCm39) missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74,943,801 (GRCm39) missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74,967,501 (GRCm39) missense probably benign 0.05
R0077:Cfap65 UTSW 1 74,971,077 (GRCm39) missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74,971,117 (GRCm39) nonsense probably null
R0281:Cfap65 UTSW 1 74,966,230 (GRCm39) missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74,943,226 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,461 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,460 (GRCm39) missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74,965,603 (GRCm39) missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74,959,760 (GRCm39) missense probably benign 0.00
R0361:Cfap65 UTSW 1 74,964,599 (GRCm39) missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74,956,043 (GRCm39) missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74,957,603 (GRCm39) missense probably benign 0.01
R0646:Cfap65 UTSW 1 74,941,328 (GRCm39) missense probably benign 0.09
R0734:Cfap65 UTSW 1 74,958,046 (GRCm39) missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74,943,841 (GRCm39) missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74,960,678 (GRCm39) missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74,944,872 (GRCm39) missense probably damaging 0.99
R1079:Cfap65 UTSW 1 74,941,606 (GRCm39) missense probably damaging 0.98
R1083:Cfap65 UTSW 1 74,957,663 (GRCm39) splice site probably benign
R1159:Cfap65 UTSW 1 74,968,499 (GRCm39) missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74,964,263 (GRCm39) missense probably benign 0.03
R1644:Cfap65 UTSW 1 74,956,334 (GRCm39) missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74,958,107 (GRCm39) missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74,946,819 (GRCm39) missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74,956,358 (GRCm39) missense probably benign 0.30
R2132:Cfap65 UTSW 1 74,946,850 (GRCm39) missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74,956,432 (GRCm39) frame shift probably null
R2219:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74,965,634 (GRCm39) missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74,966,345 (GRCm39) small insertion probably benign
R3114:Cfap65 UTSW 1 74,966,291 (GRCm39) missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74,959,701 (GRCm39) missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74,966,840 (GRCm39) missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74,942,517 (GRCm39) missense probably benign 0.17
R4547:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74,943,215 (GRCm39) missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74,964,513 (GRCm39) intron probably benign
R4701:Cfap65 UTSW 1 74,958,067 (GRCm39) missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74,967,520 (GRCm39) missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74,966,791 (GRCm39) missense probably benign 0.06
R4831:Cfap65 UTSW 1 74,956,454 (GRCm39) missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74,964,716 (GRCm39) missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74,958,420 (GRCm39) missense probably benign 0.00
R4881:Cfap65 UTSW 1 74,946,772 (GRCm39) missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74,942,283 (GRCm39) missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74,945,495 (GRCm39) nonsense probably null
R5074:Cfap65 UTSW 1 74,962,137 (GRCm39) missense probably benign 0.04
R5083:Cfap65 UTSW 1 74,945,600 (GRCm39) missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74,965,675 (GRCm39) missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74,964,061 (GRCm39) missense probably benign 0.07
R5333:Cfap65 UTSW 1 74,942,334 (GRCm39) missense probably benign 0.03
R5417:Cfap65 UTSW 1 74,964,259 (GRCm39) missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74,946,677 (GRCm39) intron probably benign
R5669:Cfap65 UTSW 1 74,964,127 (GRCm39) missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74,962,190 (GRCm39) missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74,959,564 (GRCm39) missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74,942,298 (GRCm39) missense probably benign 0.14
R6425:Cfap65 UTSW 1 74,966,868 (GRCm39) missense probably benign 0.00
R6677:Cfap65 UTSW 1 74,943,844 (GRCm39) missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74,956,445 (GRCm39) missense probably benign 0.00
R6838:Cfap65 UTSW 1 74,971,180 (GRCm39) missense probably benign 0.06
R6861:Cfap65 UTSW 1 74,964,274 (GRCm39) missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74,971,058 (GRCm39) missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74,965,792 (GRCm39) missense probably benign 0.01
R7320:Cfap65 UTSW 1 74,965,763 (GRCm39) missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74,960,742 (GRCm39) missense probably benign 0.07
R7426:Cfap65 UTSW 1 74,959,585 (GRCm39) missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74,965,769 (GRCm39) missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74,941,593 (GRCm39) missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74,972,303 (GRCm39) missense probably benign 0.44
R7704:Cfap65 UTSW 1 74,967,527 (GRCm39) missense probably benign 0.19
R7727:Cfap65 UTSW 1 74,965,784 (GRCm39) missense probably benign 0.00
R8215:Cfap65 UTSW 1 74,949,902 (GRCm39) missense probably damaging 1.00
R8344:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8345:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8413:Cfap65 UTSW 1 74,956,328 (GRCm39) nonsense probably null
R8431:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8432:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8528:Cfap65 UTSW 1 74,945,096 (GRCm39) missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74,942,382 (GRCm39) missense probably benign 0.43
R8996:Cfap65 UTSW 1 74,941,347 (GRCm39) missense probably benign 0.11
R9020:Cfap65 UTSW 1 74,959,552 (GRCm39) missense probably damaging 1.00
R9043:Cfap65 UTSW 1 74,943,847 (GRCm39) missense possibly damaging 0.88
R9127:Cfap65 UTSW 1 74,958,510 (GRCm39) splice site probably benign
R9187:Cfap65 UTSW 1 74,956,517 (GRCm39) missense probably benign 0.00
R9210:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9212:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9273:Cfap65 UTSW 1 74,960,769 (GRCm39) missense probably benign 0.00
R9454:Cfap65 UTSW 1 74,944,210 (GRCm39) missense probably damaging 1.00
R9514:Cfap65 UTSW 1 74,945,468 (GRCm39) critical splice donor site probably null
R9595:Cfap65 UTSW 1 74,946,537 (GRCm39) missense probably damaging 1.00
R9721:Cfap65 UTSW 1 74,958,501 (GRCm39) missense probably benign 0.16
R9742:Cfap65 UTSW 1 74,943,840 (GRCm39) missense probably benign 0.08
RF009:Cfap65 UTSW 1 74,944,806 (GRCm39) missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74,949,906 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACGTTCACCCTATTGTACTGTG -3'
(R):5'- AAAGCTCTGGGCCTTTTGTTC -3'

Sequencing Primer
(F):5'- ATTGTACTGTGACCATGGCC -3'
(R):5'- GTTCAGCCTCGTGCCTCAAG -3'
Posted On 2019-12-20