Incidental Mutation 'R7895:Lrp2'
ID 609574
Institutional Source Beutler Lab
Gene Symbol Lrp2
Ensembl Gene ENSMUSG00000027070
Gene Name low density lipoprotein receptor-related protein 2
Synonyms D230004K18Rik, b2b1625.2Clo, Megalin, Gp330
MMRRC Submission 045947-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7895 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 69254679-69416373 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 69288823 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 3681 (D3681G)
Ref Sequence ENSEMBL: ENSMUSP00000079752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080953]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000080953
AA Change: D3681G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000079752
Gene: ENSMUSG00000027070
AA Change: D3681G

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
LDLa 27 64 5.63e-13 SMART
LDLa 66 105 2.25e-12 SMART
EGF 107 143 2.59e1 SMART
LDLa 107 144 9.29e-14 SMART
LDLa 146 181 6.18e-10 SMART
LDLa 182 219 1.08e-14 SMART
LDLa 221 258 1.05e-12 SMART
LDLa 264 302 1.66e-10 SMART
EGF 310 346 3.23e0 SMART
EGF 350 385 2.32e-1 SMART
LY 414 457 3.88e-3 SMART
LY 458 500 1.17e-6 SMART
LY 501 547 5.96e-13 SMART
LY 548 590 1.94e-12 SMART
LY 591 634 2.66e0 SMART
EGF 661 704 7.76e-3 SMART
LY 732 774 1.76e0 SMART
LY 775 817 3.64e-8 SMART
LY 818 860 1.11e-3 SMART
LY 861 903 2.11e-13 SMART
LY 905 946 9.33e-1 SMART
EGF 972 1013 1.73e0 SMART
LDLa 1024 1061 1.05e-12 SMART
LDLa 1065 1103 4.65e-14 SMART
LDLa 1109 1146 3.63e-16 SMART
LDLa 1149 1186 5.5e-16 SMART
LDLa 1187 1225 1.43e-14 SMART
LDLa 1230 1269 2.1e-12 SMART
LDLa 1271 1308 3.63e-16 SMART
LDLa 1312 1351 4.69e-10 SMART
EGF 1353 1390 9.7e-4 SMART
EGF_CA 1391 1430 6.54e-10 SMART
LY 1457 1501 1.43e-1 SMART
LY 1502 1544 2e-14 SMART
LY 1545 1590 3.03e-14 SMART
LY 1591 1633 5.48e-12 SMART
LY 1635 1677 1.18e-2 SMART
EGF 1704 1742 5.2e-4 SMART
LY 1771 1812 1.68e1 SMART
LY 1813 1856 1.91e-2 SMART
LY 1859 1911 1.88e-10 SMART
LY 1912 1954 7.69e-7 SMART
LY 1955 1994 3e1 SMART
EGF 2022 2060 1.18e-2 SMART
LY 2088 2135 1.14e1 SMART
LY 2136 2182 2.11e-4 SMART
LY 2183 2226 2.22e-12 SMART
LY 2227 2269 1.24e-10 SMART
EGF 2346 2384 2.07e1 SMART
LY 2459 2501 9.91e-10 SMART
LY 2503 2543 1.48e-8 SMART
LY 2544 2586 6.85e-13 SMART
LY 2587 2627 8.13e-1 SMART
EGF_like 2655 2694 3.5e1 SMART
LDLa 2700 2739 2.86e-14 SMART
LDLa 2741 2778 8.09e-14 SMART
LDLa 2780 2820 3.19e-12 SMART
LDLa 2822 2862 6.94e-13 SMART
LDLa 2864 2903 9.29e-14 SMART
LDLa 2907 2947 4.79e-16 SMART
LDLa 2949 2992 8.41e-12 SMART
LDLa 2994 3031 1.08e-14 SMART
LDLa 3033 3072 1.83e-12 SMART
LDLa 3076 3113 1.16e-14 SMART
EGF 3115 3153 8.57e-5 SMART
EGF_CA 3154 3194 3.56e-11 SMART
LY 3221 3263 9.77e-9 SMART
LY 3264 3306 1.22e-9 SMART
LY 3312 3358 5.44e-7 SMART
LY 3359 3401 1.83e-13 SMART
LY 3402 3443 1.41e-5 SMART
EGF 3470 3511 8.91e-3 SMART
LDLa 3513 3552 1.79e-15 SMART
LDLa 3554 3593 9.89e-9 SMART
LDLa 3595 3634 3.07e-14 SMART
LDLa 3636 3675 3.34e-15 SMART
LDLa 3679 3718 1.39e-12 SMART
LDLa 3720 3758 3.83e-15 SMART
LDLa 3760 3797 7.15e-15 SMART
LDLa 3799 3836 2.86e-14 SMART
LDLa 3843 3882 2.38e-11 SMART
LDLa 3884 3924 3.66e-12 SMART
LDLa 3929 3966 1.93e-11 SMART
EGF 3971 4008 6.3e-3 SMART
EGF_CA 4009 4050 1.36e-7 SMART
low complexity region 4072 4084 N/A INTRINSIC
LY 4136 4178 6.2e-11 SMART
LY 4179 4222 4.32e-10 SMART
LY 4223 4266 3.78e-15 SMART
LY 4267 4306 4.53e1 SMART
EGF 4335 4367 3.46e0 SMART
EGF 4368 4413 1.53e-1 SMART
transmembrane domain 4425 4447 N/A INTRINSIC
low complexity region 4454 4472 N/A INTRINSIC
low complexity region 4616 4636 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (92/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, low density lipoprotein-related protein 2 (LRP2) or megalin, is a multi-ligand endocytic receptor that is expressed in many different tissues but primarily in absorptive epithilial tissues such as the kidney. This glycoprotein has a large amino-terminal extracellular domain, a single transmembrane domain, and a short carboxy-terminal cytoplasmic tail. The extracellular ligand-binding-domains bind diverse macromolecules including albumin, apolipoproteins B and E, and lipoprotein lipase. The LRP2 protein is critical for the reuptake of numerous ligands, including lipoproteins, sterols, vitamin-binding proteins, and hormones. This protein also has a role in cell-signaling; extracellular ligands include parathyroid horomones and the morphogen sonic hedgehog while cytosolic ligands include MAP kinase scaffold proteins and JNK interacting proteins. Recycling of this membrane receptor is regulated by phosphorylation of its cytoplasmic domain. Mutations in this gene cause Donnai-Barrow syndrome (DBS) and facio-oculoacoustico-renal syndrome (FOAR).[provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit lung and kidney epithelial defects, impaired B12 uptake, reduced proliferation of the neuroepithelium resulting in lack of olfactory bulbs, forebrain fusions, ventricular defects, and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,106,295 (GRCm39) S143T probably benign Het
9030624G23Rik A T 12: 24,094,724 (GRCm39) M149K unknown Het
Aadacl4fm4 A T 4: 144,396,913 (GRCm39) I273K possibly damaging Het
Agpat3 T A 10: 78,119,034 (GRCm39) I187F probably benign Het
Ahcyl1 C T 3: 107,576,467 (GRCm39) A332T probably damaging Het
Aldh3b3 A G 19: 4,014,871 (GRCm39) I123V possibly damaging Het
Ap5z1 T A 5: 142,456,313 (GRCm39) probably null Het
Apob A T 12: 8,061,933 (GRCm39) I3472F probably benign Het
Arhgef33 C T 17: 80,680,914 (GRCm39) P685S probably benign Het
Arhgef4 T C 1: 34,845,478 (GRCm39) I130T probably damaging Het
Arnt2 A T 7: 83,954,406 (GRCm39) F263I probably benign Het
Bbof1 A G 12: 84,466,763 (GRCm39) R177G probably damaging Het
Bbs2 C A 8: 94,807,764 (GRCm39) G372W probably damaging Het
Blmh T A 11: 76,836,721 (GRCm39) probably null Het
Ccdc30 A T 4: 119,209,910 (GRCm39) probably null Het
Cdca7l G T 12: 117,837,467 (GRCm39) L219F probably damaging Het
Cenpu C A 8: 47,015,499 (GRCm39) A138E probably benign Het
Cfap65 T A 1: 74,972,321 (GRCm39) T13S probably benign Het
Clasp2 A G 9: 113,733,016 (GRCm39) M951V probably benign Het
Clca4a A G 3: 144,674,166 (GRCm39) S190P probably benign Het
Clcn4 A G 7: 7,298,167 (GRCm39) V74A probably benign Het
Cntln C T 4: 84,981,561 (GRCm39) T913M possibly damaging Het
Cntnap4 T A 8: 113,478,829 (GRCm39) V185E probably damaging Het
Col26a1 C T 5: 136,777,031 (GRCm39) probably null Het
Ctcf A T 8: 106,390,690 (GRCm39) Q99L possibly damaging Het
Dgke T C 11: 88,931,682 (GRCm39) Q524R probably damaging Het
Dhrs7 A T 12: 72,699,234 (GRCm39) probably null Het
Dnah7b T C 1: 46,289,110 (GRCm39) Y2969H probably damaging Het
Dync1h1 T G 12: 110,582,891 (GRCm39) I358S probably damaging Het
Efcab3 A C 11: 105,008,150 (GRCm39) D410A probably benign Het
Emilin2 T C 17: 71,580,908 (GRCm39) D606G probably benign Het
Ermard C T 17: 15,283,875 (GRCm39) T622I possibly damaging Het
Exo1 A G 1: 175,728,562 (GRCm39) D542G probably benign Het
Fgd5 A T 6: 91,964,262 (GRCm39) D165V probably benign Het
Gdap1 T C 1: 17,231,368 (GRCm39) W238R probably damaging Het
Gm11096 T G 17: 81,749,328 (GRCm39) I7M unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,450 (GRCm39) probably benign Het
Gmppb A T 9: 107,927,770 (GRCm39) M175L probably benign Het
Gorasp2 G A 2: 70,514,442 (GRCm39) S273N probably benign Het
Gtf3c1 T C 7: 125,271,994 (GRCm39) M642V possibly damaging Het
Hmx2 T A 7: 131,157,600 (GRCm39) L238Q probably damaging Het
Kif13b A G 14: 64,973,598 (GRCm39) D316G probably damaging Het
Kmt2c A G 5: 25,578,174 (GRCm39) S701P possibly damaging Het
Lama4 T A 10: 38,964,325 (GRCm39) N1332K probably damaging Het
Maml3 G T 3: 51,605,143 (GRCm39) P722Q probably damaging Het
Mier2 C A 10: 79,377,719 (GRCm39) probably benign Het
Ms4a15 A T 19: 10,956,694 (GRCm39) probably null Het
Msh5 T C 17: 35,263,355 (GRCm39) M158V probably benign Het
Nova2 A T 7: 18,676,270 (GRCm39) K136I Het
Npm1 A T 11: 33,106,001 (GRCm39) probably null Het
Nr4a3 T A 4: 48,051,390 (GRCm39) M48K probably benign Het
Nrap T G 19: 56,342,584 (GRCm39) T806P probably benign Het
Ntf3 G A 6: 126,079,203 (GRCm39) T101M probably benign Het
Or2aj4 G A 16: 19,385,472 (GRCm39) R54* probably null Het
Paxbp1 T A 16: 90,822,166 (GRCm39) D648V probably damaging Het
Pcdhb18 T A 18: 37,623,520 (GRCm39) D283E probably benign Het
Phrf1 C A 7: 140,839,288 (GRCm39) Q828K unknown Het
Pigq A T 17: 26,156,299 (GRCm39) I43N probably benign Het
Pou6f2 G T 13: 18,300,033 (GRCm39) T542K Het
Ppfibp2 T A 7: 107,320,524 (GRCm39) probably null Het
Rab1b A T 19: 5,150,524 (GRCm39) M163K probably benign Het
Ralgapa1 A G 12: 55,793,934 (GRCm39) M567T probably benign Het
Reck T C 4: 43,890,970 (GRCm39) V36A probably benign Het
Resp18 C T 1: 75,254,846 (GRCm39) D36N probably null Het
Rint1 A C 5: 24,005,720 (GRCm39) H134P probably damaging Het
Rps19 A T 7: 24,587,764 (GRCm39) K77M possibly damaging Het
Sec24b A T 3: 129,789,598 (GRCm39) S808T probably benign Het
Sema4c A C 1: 36,592,199 (GRCm39) V216G probably damaging Het
Septin10 T A 10: 59,016,871 (GRCm39) T218S probably benign Het
Septin3 A T 15: 82,170,020 (GRCm39) H182L probably benign Het
Sipa1 A G 19: 5,702,690 (GRCm39) S836P probably benign Het
Slc9a5 A G 8: 106,089,998 (GRCm39) K652R probably damaging Het
Slco5a1 T A 1: 13,059,927 (GRCm39) I265F possibly damaging Het
Snapc5 T A 9: 64,086,614 (GRCm39) M1K probably null Het
Snx5 T A 2: 144,095,740 (GRCm39) D307V possibly damaging Het
Srebf2 A T 15: 82,061,441 (GRCm39) M381L probably benign Het
Ssh2 G C 11: 77,345,452 (GRCm39) E1146Q probably benign Het
Suco A T 1: 161,672,937 (GRCm39) probably null Het
Tanc2 T A 11: 105,812,651 (GRCm39) L1365Q probably damaging Het
Tas1r3 A G 4: 155,947,005 (GRCm39) L200P probably damaging Het
Thbs2 T G 17: 14,896,483 (GRCm39) D802A probably damaging Het
Trav3-1 G A 14: 52,818,550 (GRCm39) V75M probably benign Het
Trim9 G A 12: 70,301,961 (GRCm39) P559L probably benign Het
Trpc6 G A 9: 8,655,219 (GRCm39) G683D probably damaging Het
Unc5b C A 10: 60,615,509 (GRCm39) V164L possibly damaging Het
Usf3 A T 16: 44,036,565 (GRCm39) R348S possibly damaging Het
Vmn1r236 T C 17: 21,507,728 (GRCm39) V282A possibly damaging Het
Vmn2r1 A G 3: 63,997,130 (GRCm39) E262G possibly damaging Het
Xirp2 A G 2: 67,339,841 (GRCm39) E694G probably damaging Het
Xpo4 T A 14: 57,840,048 (GRCm39) H572L probably benign Het
Zfhx4 A G 3: 5,307,259 (GRCm39) T162A probably benign Het
Zfp110 T A 7: 12,571,020 (GRCm39) H59Q possibly damaging Het
Other mutations in Lrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Lrp2 APN 2 69,338,123 (GRCm39) missense probably damaging 1.00
IGL00594:Lrp2 APN 2 69,316,624 (GRCm39) missense probably benign 0.00
IGL00782:Lrp2 APN 2 69,331,989 (GRCm39) missense probably benign 0.14
IGL00821:Lrp2 APN 2 69,289,860 (GRCm39) missense probably damaging 1.00
IGL00897:Lrp2 APN 2 69,352,225 (GRCm39) missense possibly damaging 0.86
IGL01065:Lrp2 APN 2 69,299,780 (GRCm39) missense possibly damaging 0.94
IGL01087:Lrp2 APN 2 69,354,417 (GRCm39) missense probably damaging 1.00
IGL01095:Lrp2 APN 2 69,322,776 (GRCm39) nonsense probably null
IGL01131:Lrp2 APN 2 69,329,583 (GRCm39) missense probably damaging 1.00
IGL01350:Lrp2 APN 2 69,341,328 (GRCm39) missense probably damaging 0.96
IGL01352:Lrp2 APN 2 69,333,870 (GRCm39) missense possibly damaging 0.77
IGL01358:Lrp2 APN 2 69,382,814 (GRCm39) splice site probably benign
IGL01375:Lrp2 APN 2 69,308,910 (GRCm39) splice site probably benign
IGL01384:Lrp2 APN 2 69,313,846 (GRCm39) missense probably damaging 1.00
IGL01384:Lrp2 APN 2 69,284,156 (GRCm39) missense probably null 1.00
IGL01411:Lrp2 APN 2 69,312,611 (GRCm39) missense probably damaging 1.00
IGL01418:Lrp2 APN 2 69,355,630 (GRCm39) missense probably benign
IGL01444:Lrp2 APN 2 69,274,060 (GRCm39) missense possibly damaging 0.94
IGL01464:Lrp2 APN 2 69,302,783 (GRCm39) missense probably damaging 0.98
IGL01528:Lrp2 APN 2 69,322,804 (GRCm39) missense probably damaging 1.00
IGL01663:Lrp2 APN 2 69,259,050 (GRCm39) missense probably benign
IGL01761:Lrp2 APN 2 69,311,579 (GRCm39) missense possibly damaging 0.85
IGL01780:Lrp2 APN 2 69,316,528 (GRCm39) missense possibly damaging 0.66
IGL01994:Lrp2 APN 2 69,313,945 (GRCm39) missense probably benign 0.08
IGL02015:Lrp2 APN 2 69,357,922 (GRCm39) missense probably benign 0.00
IGL02104:Lrp2 APN 2 69,340,762 (GRCm39) missense probably damaging 1.00
IGL02132:Lrp2 APN 2 69,367,960 (GRCm39) missense probably benign 0.01
IGL02134:Lrp2 APN 2 69,343,723 (GRCm39) critical splice acceptor site probably null
IGL02197:Lrp2 APN 2 69,297,224 (GRCm39) missense probably benign 0.01
IGL02212:Lrp2 APN 2 69,281,608 (GRCm39) missense probably benign 0.00
IGL02240:Lrp2 APN 2 69,365,390 (GRCm39) missense probably benign
IGL02248:Lrp2 APN 2 69,313,152 (GRCm39) missense probably damaging 1.00
IGL02369:Lrp2 APN 2 69,294,980 (GRCm39) missense probably damaging 1.00
IGL02416:Lrp2 APN 2 69,299,977 (GRCm39) missense probably damaging 1.00
IGL02417:Lrp2 APN 2 69,291,649 (GRCm39) missense probably damaging 1.00
IGL02458:Lrp2 APN 2 69,352,117 (GRCm39) missense probably damaging 0.97
IGL02479:Lrp2 APN 2 69,295,145 (GRCm39) splice site probably benign
IGL02508:Lrp2 APN 2 69,333,774 (GRCm39) missense probably benign 0.04
IGL02751:Lrp2 APN 2 69,363,806 (GRCm39) missense possibly damaging 0.56
IGL02814:Lrp2 APN 2 69,337,080 (GRCm39) missense probably damaging 1.00
IGL02867:Lrp2 APN 2 69,382,794 (GRCm39) missense possibly damaging 0.67
IGL02889:Lrp2 APN 2 69,382,794 (GRCm39) missense possibly damaging 0.67
IGL02943:Lrp2 APN 2 69,285,854 (GRCm39) missense possibly damaging 0.86
IGL02948:Lrp2 APN 2 69,318,181 (GRCm39) missense probably damaging 1.00
IGL02960:Lrp2 APN 2 69,285,797 (GRCm39) splice site probably benign
IGL02990:Lrp2 APN 2 69,271,740 (GRCm39) missense possibly damaging 0.56
IGL03027:Lrp2 APN 2 69,367,897 (GRCm39) missense probably benign 0.43
IGL03038:Lrp2 APN 2 69,305,808 (GRCm39) missense probably damaging 0.99
IGL03064:Lrp2 APN 2 69,313,477 (GRCm39) missense probably damaging 0.98
IGL03107:Lrp2 APN 2 69,285,177 (GRCm39) missense probably damaging 1.00
IGL03141:Lrp2 APN 2 69,307,370 (GRCm39) missense probably damaging 0.99
IGL03154:Lrp2 APN 2 69,379,386 (GRCm39) missense probably damaging 1.00
IGL03155:Lrp2 APN 2 69,285,796 (GRCm39) splice site probably benign
IGL03163:Lrp2 APN 2 69,331,870 (GRCm39) nonsense probably null
IGL03164:Lrp2 APN 2 69,295,043 (GRCm39) missense probably damaging 1.00
IGL03169:Lrp2 APN 2 69,353,538 (GRCm39) missense probably damaging 1.00
IGL03174:Lrp2 APN 2 69,296,609 (GRCm39) missense probably damaging 1.00
IGL03189:Lrp2 APN 2 69,268,822 (GRCm39) splice site probably benign
IGL03288:Lrp2 APN 2 69,256,383 (GRCm39) missense probably benign 0.02
IGL03350:Lrp2 APN 2 69,268,797 (GRCm39) missense probably damaging 1.00
IGL03378:Lrp2 APN 2 69,261,496 (GRCm39) missense probably damaging 1.00
casual UTSW 2 69,329,607 (GRCm39) missense probably benign
nonchalant UTSW 2 69,319,673 (GRCm39) missense probably damaging 1.00
Presto UTSW 2 69,289,875 (GRCm39) nonsense probably null
relaxed UTSW 2 69,365,349 (GRCm39) missense probably damaging 1.00
unguarded UTSW 2 69,296,102 (GRCm39) missense probably benign 0.00
Unintended UTSW 2 69,348,787 (GRCm39) missense probably damaging 1.00
BB009:Lrp2 UTSW 2 69,256,371 (GRCm39) missense probably benign 0.00
BB019:Lrp2 UTSW 2 69,256,371 (GRCm39) missense probably benign 0.00
IGL02835:Lrp2 UTSW 2 69,335,648 (GRCm39) missense probably damaging 1.00
IGL03055:Lrp2 UTSW 2 69,288,792 (GRCm39) missense probably damaging 1.00
PIT4362001:Lrp2 UTSW 2 69,367,882 (GRCm39) missense probably damaging 1.00
PIT4504001:Lrp2 UTSW 2 69,305,747 (GRCm39) missense probably damaging 1.00
R0008:Lrp2 UTSW 2 69,346,895 (GRCm39) missense probably benign 0.42
R0008:Lrp2 UTSW 2 69,346,895 (GRCm39) missense probably benign 0.42
R0044:Lrp2 UTSW 2 69,357,899 (GRCm39) missense probably benign 0.01
R0044:Lrp2 UTSW 2 69,357,899 (GRCm39) missense probably damaging 0.96
R0048:Lrp2 UTSW 2 69,295,971 (GRCm39) missense probably damaging 1.00
R0098:Lrp2 UTSW 2 69,305,756 (GRCm39) missense probably damaging 1.00
R0098:Lrp2 UTSW 2 69,305,756 (GRCm39) missense probably damaging 1.00
R0103:Lrp2 UTSW 2 69,307,384 (GRCm39) missense probably benign
R0167:Lrp2 UTSW 2 69,256,002 (GRCm39) missense possibly damaging 0.95
R0226:Lrp2 UTSW 2 69,367,907 (GRCm39) missense probably null 1.00
R0243:Lrp2 UTSW 2 69,258,974 (GRCm39) missense probably benign 0.00
R0308:Lrp2 UTSW 2 69,313,326 (GRCm39) splice site probably benign
R0323:Lrp2 UTSW 2 69,299,983 (GRCm39) missense probably damaging 1.00
R0372:Lrp2 UTSW 2 69,365,387 (GRCm39) missense probably benign 0.10
R0374:Lrp2 UTSW 2 69,260,651 (GRCm39) missense probably damaging 1.00
R0391:Lrp2 UTSW 2 69,290,681 (GRCm39) splice site probably benign
R0391:Lrp2 UTSW 2 69,287,202 (GRCm39) missense probably damaging 0.99
R0395:Lrp2 UTSW 2 69,263,421 (GRCm39) missense possibly damaging 0.89
R0401:Lrp2 UTSW 2 69,309,492 (GRCm39) missense probably damaging 0.98
R0471:Lrp2 UTSW 2 69,355,578 (GRCm39) missense probably damaging 0.97
R0483:Lrp2 UTSW 2 69,338,145 (GRCm39) missense probably damaging 0.99
R0502:Lrp2 UTSW 2 69,341,361 (GRCm39) missense probably damaging 1.00
R0542:Lrp2 UTSW 2 69,258,998 (GRCm39) missense probably benign 0.00
R0544:Lrp2 UTSW 2 69,322,275 (GRCm39) missense probably benign 0.18
R0548:Lrp2 UTSW 2 69,367,982 (GRCm39) splice site probably benign
R0593:Lrp2 UTSW 2 69,297,350 (GRCm39) missense probably benign
R0608:Lrp2 UTSW 2 69,316,587 (GRCm39) missense probably benign 0.02
R0633:Lrp2 UTSW 2 69,278,464 (GRCm39) missense probably damaging 1.00
R0691:Lrp2 UTSW 2 69,281,724 (GRCm39) missense probably benign 0.19
R0718:Lrp2 UTSW 2 69,341,292 (GRCm39) missense probably damaging 1.00
R0737:Lrp2 UTSW 2 69,278,513 (GRCm39) missense probably damaging 0.96
R0771:Lrp2 UTSW 2 69,338,334 (GRCm39) missense probably damaging 1.00
R0784:Lrp2 UTSW 2 69,348,709 (GRCm39) missense probably benign 0.32
R0885:Lrp2 UTSW 2 69,312,697 (GRCm39) missense possibly damaging 0.75
R0947:Lrp2 UTSW 2 69,318,182 (GRCm39) missense probably damaging 1.00
R1235:Lrp2 UTSW 2 69,354,380 (GRCm39) missense probably damaging 1.00
R1293:Lrp2 UTSW 2 69,353,646 (GRCm39) splice site probably null
R1301:Lrp2 UTSW 2 69,258,948 (GRCm39) missense probably damaging 0.98
R1387:Lrp2 UTSW 2 69,287,262 (GRCm39) missense probably damaging 1.00
R1459:Lrp2 UTSW 2 69,313,738 (GRCm39) missense probably damaging 0.99
R1459:Lrp2 UTSW 2 69,290,821 (GRCm39) missense probably damaging 1.00
R1529:Lrp2 UTSW 2 69,353,526 (GRCm39) missense probably damaging 1.00
R1543:Lrp2 UTSW 2 69,331,074 (GRCm39) missense probably damaging 1.00
R1546:Lrp2 UTSW 2 69,332,954 (GRCm39) missense probably damaging 1.00
R1550:Lrp2 UTSW 2 69,333,005 (GRCm39) missense possibly damaging 0.74
R1590:Lrp2 UTSW 2 69,297,107 (GRCm39) critical splice donor site probably null
R1689:Lrp2 UTSW 2 69,333,873 (GRCm39) missense probably benign 0.09
R1693:Lrp2 UTSW 2 69,340,762 (GRCm39) missense probably damaging 1.00
R1753:Lrp2 UTSW 2 69,326,833 (GRCm39) missense possibly damaging 0.87
R1799:Lrp2 UTSW 2 69,333,874 (GRCm39) missense probably benign 0.04
R1834:Lrp2 UTSW 2 69,297,224 (GRCm39) missense probably benign 0.01
R1921:Lrp2 UTSW 2 69,353,631 (GRCm39) missense probably damaging 1.00
R2000:Lrp2 UTSW 2 69,297,434 (GRCm39) missense probably damaging 1.00
R2077:Lrp2 UTSW 2 69,338,187 (GRCm39) missense probably damaging 1.00
R2092:Lrp2 UTSW 2 69,366,365 (GRCm39) missense probably benign 0.25
R2093:Lrp2 UTSW 2 69,366,365 (GRCm39) missense probably benign 0.25
R2108:Lrp2 UTSW 2 69,336,968 (GRCm39) missense possibly damaging 0.75
R2117:Lrp2 UTSW 2 69,313,729 (GRCm39) missense probably benign 0.05
R2122:Lrp2 UTSW 2 69,314,051 (GRCm39) missense probably damaging 1.00
R2134:Lrp2 UTSW 2 69,341,411 (GRCm39) missense probably damaging 1.00
R2207:Lrp2 UTSW 2 69,297,372 (GRCm39) missense possibly damaging 0.94
R2248:Lrp2 UTSW 2 69,341,354 (GRCm39) missense probably damaging 1.00
R2264:Lrp2 UTSW 2 69,312,710 (GRCm39) missense possibly damaging 0.88
R2316:Lrp2 UTSW 2 69,322,191 (GRCm39) missense possibly damaging 0.75
R2513:Lrp2 UTSW 2 69,336,718 (GRCm39) splice site probably null
R2984:Lrp2 UTSW 2 69,256,158 (GRCm39) splice site probably null
R3085:Lrp2 UTSW 2 69,297,479 (GRCm39) missense probably benign 0.05
R3103:Lrp2 UTSW 2 69,262,328 (GRCm39) missense probably benign 0.00
R3727:Lrp2 UTSW 2 69,340,773 (GRCm39) missense probably damaging 1.00
R3730:Lrp2 UTSW 2 69,294,923 (GRCm39) missense probably damaging 0.99
R3730:Lrp2 UTSW 2 69,365,251 (GRCm39) critical splice donor site probably null
R3731:Lrp2 UTSW 2 69,294,923 (GRCm39) missense probably damaging 0.99
R3731:Lrp2 UTSW 2 69,365,251 (GRCm39) critical splice donor site probably null
R3764:Lrp2 UTSW 2 69,326,680 (GRCm39) missense probably damaging 1.00
R3768:Lrp2 UTSW 2 69,335,449 (GRCm39) missense probably benign 0.34
R3778:Lrp2 UTSW 2 69,339,548 (GRCm39) missense probably benign 0.00
R3808:Lrp2 UTSW 2 69,331,892 (GRCm39) missense probably damaging 1.00
R3809:Lrp2 UTSW 2 69,331,892 (GRCm39) missense probably damaging 1.00
R3813:Lrp2 UTSW 2 69,294,923 (GRCm39) missense probably damaging 0.99
R3828:Lrp2 UTSW 2 69,256,356 (GRCm39) missense probably benign 0.03
R3852:Lrp2 UTSW 2 69,367,909 (GRCm39) missense probably damaging 0.96
R3877:Lrp2 UTSW 2 69,289,816 (GRCm39) critical splice donor site probably null
R3877:Lrp2 UTSW 2 69,379,391 (GRCm39) missense probably damaging 1.00
R3922:Lrp2 UTSW 2 69,336,720 (GRCm39) missense probably benign
R4081:Lrp2 UTSW 2 69,343,617 (GRCm39) missense probably damaging 0.98
R4082:Lrp2 UTSW 2 69,343,617 (GRCm39) missense probably damaging 0.98
R4118:Lrp2 UTSW 2 69,260,606 (GRCm39) critical splice donor site probably null
R4193:Lrp2 UTSW 2 69,297,487 (GRCm39) missense probably damaging 1.00
R4284:Lrp2 UTSW 2 69,310,438 (GRCm39) missense possibly damaging 0.95
R4322:Lrp2 UTSW 2 69,256,335 (GRCm39) nonsense probably null
R4352:Lrp2 UTSW 2 69,262,526 (GRCm39) critical splice donor site probably null
R4407:Lrp2 UTSW 2 69,332,861 (GRCm39) missense probably damaging 1.00
R4408:Lrp2 UTSW 2 69,297,513 (GRCm39) missense probably benign 0.09
R4416:Lrp2 UTSW 2 69,357,575 (GRCm39) missense probably benign 0.18
R4426:Lrp2 UTSW 2 69,336,692 (GRCm39) missense probably benign 0.00
R4510:Lrp2 UTSW 2 69,310,406 (GRCm39) missense possibly damaging 0.58
R4511:Lrp2 UTSW 2 69,310,406 (GRCm39) missense possibly damaging 0.58
R4553:Lrp2 UTSW 2 69,343,629 (GRCm39) missense probably benign 0.13
R4591:Lrp2 UTSW 2 69,366,419 (GRCm39) missense probably damaging 1.00
R4612:Lrp2 UTSW 2 69,288,771 (GRCm39) nonsense probably null
R4622:Lrp2 UTSW 2 69,290,693 (GRCm39) missense possibly damaging 0.87
R4632:Lrp2 UTSW 2 69,319,473 (GRCm39) splice site probably null
R4633:Lrp2 UTSW 2 69,291,761 (GRCm39) missense probably benign 0.16
R4636:Lrp2 UTSW 2 69,266,983 (GRCm39) missense possibly damaging 0.93
R4657:Lrp2 UTSW 2 69,297,337 (GRCm39) missense probably damaging 1.00
R4667:Lrp2 UTSW 2 69,319,642 (GRCm39) missense probably benign 0.02
R4712:Lrp2 UTSW 2 69,336,895 (GRCm39) missense probably damaging 1.00
R4713:Lrp2 UTSW 2 69,318,310 (GRCm39) missense probably damaging 1.00
R4720:Lrp2 UTSW 2 69,311,517 (GRCm39) missense probably damaging 0.99
R4732:Lrp2 UTSW 2 69,363,899 (GRCm39) missense probably benign
R4733:Lrp2 UTSW 2 69,363,899 (GRCm39) missense probably benign
R4777:Lrp2 UTSW 2 69,312,608 (GRCm39) missense probably damaging 1.00
R4779:Lrp2 UTSW 2 69,290,059 (GRCm39) missense possibly damaging 0.75
R4786:Lrp2 UTSW 2 69,368,300 (GRCm39) missense probably damaging 1.00
R4842:Lrp2 UTSW 2 69,299,755 (GRCm39) missense probably benign 0.06
R4845:Lrp2 UTSW 2 69,339,585 (GRCm39) missense possibly damaging 0.71
R4846:Lrp2 UTSW 2 69,309,457 (GRCm39) missense probably damaging 1.00
R4938:Lrp2 UTSW 2 69,302,712 (GRCm39) missense probably damaging 0.98
R4951:Lrp2 UTSW 2 69,366,332 (GRCm39) missense probably damaging 1.00
R4990:Lrp2 UTSW 2 69,311,732 (GRCm39) missense probably benign 0.01
R5075:Lrp2 UTSW 2 69,296,102 (GRCm39) missense probably benign 0.00
R5078:Lrp2 UTSW 2 69,331,874 (GRCm39) missense possibly damaging 0.93
R5102:Lrp2 UTSW 2 69,319,502 (GRCm39) missense probably damaging 0.98
R5124:Lrp2 UTSW 2 69,331,834 (GRCm39) missense probably damaging 0.97
R5131:Lrp2 UTSW 2 69,260,686 (GRCm39) missense possibly damaging 0.74
R5141:Lrp2 UTSW 2 69,382,693 (GRCm39) splice site probably null
R5223:Lrp2 UTSW 2 69,354,397 (GRCm39) missense probably damaging 0.99
R5236:Lrp2 UTSW 2 69,287,163 (GRCm39) splice site probably null
R5267:Lrp2 UTSW 2 69,379,322 (GRCm39) missense possibly damaging 0.83
R5290:Lrp2 UTSW 2 69,343,698 (GRCm39) missense probably damaging 1.00
R5333:Lrp2 UTSW 2 69,355,572 (GRCm39) missense probably benign 0.01
R5355:Lrp2 UTSW 2 69,285,182 (GRCm39) nonsense probably null
R5356:Lrp2 UTSW 2 69,295,052 (GRCm39) missense possibly damaging 0.74
R5369:Lrp2 UTSW 2 69,289,904 (GRCm39) missense probably benign 0.04
R5486:Lrp2 UTSW 2 69,267,809 (GRCm39) missense probably benign 0.04
R5554:Lrp2 UTSW 2 69,382,768 (GRCm39) missense possibly damaging 0.92
R5584:Lrp2 UTSW 2 69,281,632 (GRCm39) missense probably damaging 1.00
R5585:Lrp2 UTSW 2 69,294,968 (GRCm39) missense possibly damaging 0.77
R5587:Lrp2 UTSW 2 69,329,607 (GRCm39) missense probably benign
R5605:Lrp2 UTSW 2 69,353,643 (GRCm39) missense probably damaging 1.00
R5637:Lrp2 UTSW 2 69,302,762 (GRCm39) missense probably damaging 1.00
R5647:Lrp2 UTSW 2 69,350,258 (GRCm39) missense probably null 0.80
R5686:Lrp2 UTSW 2 69,341,405 (GRCm39) missense possibly damaging 0.88
R5691:Lrp2 UTSW 2 69,332,897 (GRCm39) missense probably damaging 1.00
R5724:Lrp2 UTSW 2 69,281,726 (GRCm39) missense probably damaging 0.99
R5726:Lrp2 UTSW 2 69,339,491 (GRCm39) missense probably damaging 1.00
R5743:Lrp2 UTSW 2 69,297,221 (GRCm39) missense probably damaging 1.00
R5777:Lrp2 UTSW 2 69,285,869 (GRCm39) missense probably damaging 1.00
R5841:Lrp2 UTSW 2 69,310,497 (GRCm39) missense probably benign 0.00
R5892:Lrp2 UTSW 2 69,273,120 (GRCm39) missense probably benign
R5951:Lrp2 UTSW 2 69,326,667 (GRCm39) splice site probably null
R5974:Lrp2 UTSW 2 69,289,892 (GRCm39) missense probably damaging 1.00
R5980:Lrp2 UTSW 2 69,365,349 (GRCm39) missense probably damaging 1.00
R6046:Lrp2 UTSW 2 69,337,098 (GRCm39) missense probably damaging 1.00
R6113:Lrp2 UTSW 2 69,313,901 (GRCm39) missense possibly damaging 0.76
R6146:Lrp2 UTSW 2 69,341,345 (GRCm39) missense probably benign 0.00
R6177:Lrp2 UTSW 2 69,340,763 (GRCm39) frame shift probably null
R6180:Lrp2 UTSW 2 69,333,868 (GRCm39) missense possibly damaging 0.85
R6219:Lrp2 UTSW 2 69,299,822 (GRCm39) missense probably damaging 1.00
R6228:Lrp2 UTSW 2 69,312,710 (GRCm39) missense possibly damaging 0.88
R6265:Lrp2 UTSW 2 69,296,684 (GRCm39) missense probably damaging 1.00
R6312:Lrp2 UTSW 2 69,267,025 (GRCm39) missense probably damaging 1.00
R6337:Lrp2 UTSW 2 69,268,811 (GRCm39) missense probably damaging 1.00
R6376:Lrp2 UTSW 2 69,313,787 (GRCm39) missense probably benign 0.02
R6385:Lrp2 UTSW 2 69,326,128 (GRCm39) missense probably benign 0.22
R6429:Lrp2 UTSW 2 69,291,631 (GRCm39) missense probably damaging 1.00
R6458:Lrp2 UTSW 2 69,335,500 (GRCm39) missense probably benign 0.00
R6524:Lrp2 UTSW 2 69,266,983 (GRCm39) missense possibly damaging 0.93
R6555:Lrp2 UTSW 2 69,339,647 (GRCm39) missense probably benign 0.00
R6594:Lrp2 UTSW 2 69,270,267 (GRCm39) missense possibly damaging 0.58
R6599:Lrp2 UTSW 2 69,299,749 (GRCm39) missense probably damaging 1.00
R6655:Lrp2 UTSW 2 69,284,202 (GRCm39) missense probably benign 0.01
R6718:Lrp2 UTSW 2 69,314,124 (GRCm39) missense probably benign 0.09
R6736:Lrp2 UTSW 2 69,278,555 (GRCm39) missense probably benign 0.02
R6738:Lrp2 UTSW 2 69,288,832 (GRCm39) missense probably damaging 0.97
R6799:Lrp2 UTSW 2 69,314,248 (GRCm39) missense probably damaging 1.00
R6846:Lrp2 UTSW 2 69,348,787 (GRCm39) missense probably damaging 1.00
R6856:Lrp2 UTSW 2 69,343,612 (GRCm39) missense probably damaging 1.00
R6861:Lrp2 UTSW 2 69,343,721 (GRCm39) missense possibly damaging 0.77
R6888:Lrp2 UTSW 2 69,354,485 (GRCm39) missense probably damaging 0.98
R6897:Lrp2 UTSW 2 69,340,846 (GRCm39) missense probably benign
R6902:Lrp2 UTSW 2 69,289,847 (GRCm39) missense probably damaging 1.00
R6908:Lrp2 UTSW 2 69,302,709 (GRCm39) missense probably damaging 1.00
R6918:Lrp2 UTSW 2 69,319,649 (GRCm39) missense probably damaging 1.00
R6989:Lrp2 UTSW 2 69,302,799 (GRCm39) missense probably damaging 1.00
R7022:Lrp2 UTSW 2 69,313,552 (GRCm39) missense probably damaging 1.00
R7025:Lrp2 UTSW 2 69,313,372 (GRCm39) missense possibly damaging 0.90
R7026:Lrp2 UTSW 2 69,352,131 (GRCm39) missense probably damaging 0.97
R7138:Lrp2 UTSW 2 69,296,089 (GRCm39) missense possibly damaging 0.94
R7145:Lrp2 UTSW 2 69,285,152 (GRCm39) critical splice donor site probably null
R7150:Lrp2 UTSW 2 69,318,395 (GRCm39) missense probably damaging 0.99
R7165:Lrp2 UTSW 2 69,336,917 (GRCm39) missense probably damaging 0.99
R7174:Lrp2 UTSW 2 69,263,416 (GRCm39) missense probably benign 0.11
R7204:Lrp2 UTSW 2 69,302,877 (GRCm39) missense probably benign 0.25
R7275:Lrp2 UTSW 2 69,289,875 (GRCm39) nonsense probably null
R7278:Lrp2 UTSW 2 69,316,696 (GRCm39) missense probably damaging 1.00
R7296:Lrp2 UTSW 2 69,312,725 (GRCm39) missense probably benign 0.04
R7315:Lrp2 UTSW 2 69,322,166 (GRCm39) missense probably damaging 0.98
R7342:Lrp2 UTSW 2 69,309,634 (GRCm39) missense possibly damaging 0.95
R7351:Lrp2 UTSW 2 69,278,486 (GRCm39) missense probably damaging 1.00
R7352:Lrp2 UTSW 2 69,302,741 (GRCm39) missense probably benign 0.04
R7366:Lrp2 UTSW 2 69,314,150 (GRCm39) missense probably damaging 1.00
R7373:Lrp2 UTSW 2 69,331,036 (GRCm39) missense probably damaging 1.00
R7446:Lrp2 UTSW 2 69,290,018 (GRCm39) missense probably damaging 0.99
R7446:Lrp2 UTSW 2 69,262,557 (GRCm39) missense probably damaging 1.00
R7451:Lrp2 UTSW 2 69,343,677 (GRCm39) missense probably damaging 1.00
R7492:Lrp2 UTSW 2 69,367,925 (GRCm39) missense probably damaging 0.99
R7571:Lrp2 UTSW 2 69,346,747 (GRCm39) missense probably damaging 1.00
R7638:Lrp2 UTSW 2 69,307,352 (GRCm39) critical splice donor site probably null
R7664:Lrp2 UTSW 2 69,337,076 (GRCm39) missense probably damaging 1.00
R7686:Lrp2 UTSW 2 69,319,581 (GRCm39) missense probably damaging 1.00
R7711:Lrp2 UTSW 2 69,309,687 (GRCm39) critical splice acceptor site probably null
R7737:Lrp2 UTSW 2 69,326,782 (GRCm39) missense possibly damaging 0.77
R7763:Lrp2 UTSW 2 69,333,732 (GRCm39) missense probably damaging 0.99
R7775:Lrp2 UTSW 2 69,331,883 (GRCm39) missense possibly damaging 0.74
R7824:Lrp2 UTSW 2 69,331,883 (GRCm39) missense possibly damaging 0.74
R7840:Lrp2 UTSW 2 69,295,128 (GRCm39) missense probably damaging 0.98
R7878:Lrp2 UTSW 2 69,338,153 (GRCm39) missense probably damaging 1.00
R7878:Lrp2 UTSW 2 69,338,154 (GRCm39) missense probably damaging 1.00
R7898:Lrp2 UTSW 2 69,271,710 (GRCm39) missense probably benign 0.00
R7912:Lrp2 UTSW 2 69,259,016 (GRCm39) missense probably benign 0.03
R7923:Lrp2 UTSW 2 69,268,732 (GRCm39) missense possibly damaging 0.75
R7932:Lrp2 UTSW 2 69,256,371 (GRCm39) missense probably benign 0.00
R7940:Lrp2 UTSW 2 69,262,541 (GRCm39) missense possibly damaging 0.91
R7954:Lrp2 UTSW 2 69,333,867 (GRCm39) missense possibly damaging 0.61
R8007:Lrp2 UTSW 2 69,336,849 (GRCm39) missense probably benign 0.02
R8084:Lrp2 UTSW 2 69,339,713 (GRCm39) missense probably damaging 0.97
R8087:Lrp2 UTSW 2 69,278,473 (GRCm39) missense probably damaging 1.00
R8090:Lrp2 UTSW 2 69,295,089 (GRCm39) missense possibly damaging 0.94
R8110:Lrp2 UTSW 2 69,336,797 (GRCm39) missense probably benign
R8129:Lrp2 UTSW 2 69,260,624 (GRCm39) missense possibly damaging 0.75
R8155:Lrp2 UTSW 2 69,313,342 (GRCm39) missense possibly damaging 0.74
R8182:Lrp2 UTSW 2 69,319,673 (GRCm39) missense probably damaging 1.00
R8239:Lrp2 UTSW 2 69,311,611 (GRCm39) nonsense probably null
R8247:Lrp2 UTSW 2 69,261,431 (GRCm39) missense possibly damaging 0.76
R8327:Lrp2 UTSW 2 69,322,268 (GRCm39) missense probably damaging 1.00
R8355:Lrp2 UTSW 2 69,346,828 (GRCm39) missense probably damaging 0.99
R8404:Lrp2 UTSW 2 69,344,585 (GRCm39) nonsense probably null
R8427:Lrp2 UTSW 2 69,281,641 (GRCm39) missense probably damaging 0.97
R8463:Lrp2 UTSW 2 69,322,250 (GRCm39) missense probably damaging 1.00
R8502:Lrp2 UTSW 2 69,344,585 (GRCm39) nonsense probably null
R8529:Lrp2 UTSW 2 69,330,986 (GRCm39) missense probably damaging 0.96
R8673:Lrp2 UTSW 2 69,302,804 (GRCm39) missense probably damaging 1.00
R8698:Lrp2 UTSW 2 69,288,767 (GRCm39) missense probably benign 0.37
R8698:Lrp2 UTSW 2 69,278,583 (GRCm39) missense probably benign 0.39
R8708:Lrp2 UTSW 2 69,289,957 (GRCm39) missense probably damaging 1.00
R8716:Lrp2 UTSW 2 69,274,138 (GRCm39) missense probably benign 0.04
R8723:Lrp2 UTSW 2 69,316,648 (GRCm39) missense probably damaging 1.00
R8787:Lrp2 UTSW 2 69,382,745 (GRCm39) missense probably damaging 1.00
R8903:Lrp2 UTSW 2 69,379,382 (GRCm39) missense possibly damaging 0.68
R8944:Lrp2 UTSW 2 69,341,348 (GRCm39) missense probably damaging 1.00
R9069:Lrp2 UTSW 2 69,331,996 (GRCm39) missense probably damaging 1.00
R9076:Lrp2 UTSW 2 69,350,260 (GRCm39) missense probably benign 0.01
R9155:Lrp2 UTSW 2 69,291,713 (GRCm39) nonsense probably null
R9173:Lrp2 UTSW 2 69,299,731 (GRCm39) missense probably damaging 1.00
R9254:Lrp2 UTSW 2 69,333,891 (GRCm39) missense probably benign 0.09
R9256:Lrp2 UTSW 2 69,341,303 (GRCm39) missense probably benign 0.03
R9291:Lrp2 UTSW 2 69,310,379 (GRCm39) missense probably damaging 1.00
R9335:Lrp2 UTSW 2 69,258,983 (GRCm39) missense probably benign 0.01
R9357:Lrp2 UTSW 2 69,336,917 (GRCm39) missense probably damaging 0.99
R9368:Lrp2 UTSW 2 69,357,979 (GRCm39) missense probably damaging 0.99
R9453:Lrp2 UTSW 2 69,288,832 (GRCm39) missense probably damaging 1.00
R9546:Lrp2 UTSW 2 69,287,165 (GRCm39) critical splice donor site probably null
R9554:Lrp2 UTSW 2 69,261,497 (GRCm39) missense probably damaging 1.00
R9597:Lrp2 UTSW 2 69,260,703 (GRCm39) missense probably benign 0.02
R9601:Lrp2 UTSW 2 69,289,928 (GRCm39) missense probably damaging 1.00
R9623:Lrp2 UTSW 2 69,307,423 (GRCm39) missense probably benign 0.09
RF016:Lrp2 UTSW 2 69,339,549 (GRCm39) missense probably benign
X0011:Lrp2 UTSW 2 69,350,342 (GRCm39) missense probably damaging 1.00
X0023:Lrp2 UTSW 2 69,266,944 (GRCm39) missense probably damaging 0.99
Z1176:Lrp2 UTSW 2 69,338,225 (GRCm39) missense possibly damaging 0.88
Z1176:Lrp2 UTSW 2 69,310,386 (GRCm39) missense possibly damaging 0.66
Z1177:Lrp2 UTSW 2 69,326,812 (GRCm39) missense probably damaging 1.00
Z1177:Lrp2 UTSW 2 69,302,797 (GRCm39) missense probably benign 0.03
Z1177:Lrp2 UTSW 2 69,281,624 (GRCm39) missense probably damaging 1.00
Z1177:Lrp2 UTSW 2 69,339,633 (GRCm39) missense probably benign 0.00
Z1177:Lrp2 UTSW 2 69,331,985 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCCTTTCCAGAGGTAAAGAG -3'
(R):5'- GTTCTGCTCATTGAACACATCAC -3'

Sequencing Primer
(F):5'- GGGACATCTATCCTTATGAGAGC -3'
(R):5'- TGCTCATTGAACACATCACACCTATC -3'
Posted On 2019-12-20