Incidental Mutation 'R0681:Tdrd7'
ID60958
Institutional Source Beutler Lab
Gene Symbol Tdrd7
Ensembl Gene ENSMUSG00000035517
Gene Nametudor domain containing 7
Synonyms5730495N10Rik
MMRRC Submission 038866-MU
Accession Numbers

Genbank: NM_146142; MGI: 2140279

Is this an essential gene? Possibly essential (E-score: 0.558) question?
Stock #R0681 (G1)
Quality Score126
Status Validated
Chromosome4
Chromosomal Location45965334-46034761 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46016879 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 673 (M673K)
Ref Sequence ENSEMBL: ENSMUSP00000103406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102929] [ENSMUST00000107777]
Predicted Effect probably benign
Transcript: ENSMUST00000102929
AA Change: M640K

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099993
Gene: ENSMUSG00000035517
AA Change: M640K

DomainStartEndE-ValueType
Pfam:OST-HTH 3 73 2.6e-10 PFAM
internal_repeat_1 223 300 2.94e-9 PROSPERO
low complexity region 302 318 N/A INTRINSIC
internal_repeat_1 326 400 2.94e-9 PROSPERO
TUDOR 500 556 2.08e-5 SMART
TUDOR 690 746 1.66e-4 SMART
TUDOR 945 1001 4.03e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107777
AA Change: M673K

PolyPhen 2 Score 0.452 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103406
Gene: ENSMUSG00000035517
AA Change: M673K

DomainStartEndE-ValueType
Pfam:OST-HTH 36 106 5.7e-11 PFAM
internal_repeat_1 256 333 3.1e-9 PROSPERO
low complexity region 335 351 N/A INTRINSIC
internal_repeat_1 359 433 3.1e-9 PROSPERO
TUDOR 533 589 2.08e-5 SMART
TUDOR 723 779 1.66e-4 SMART
TUDOR 978 1034 4.03e0 SMART
Meta Mutation Damage Score 0.1405 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Tudor family of proteins. This protein contains conserved Tudor domains and LOTUS domains. It is a component of RNA granules, which function in RNA processing. Mutations in this gene have been associated with cataract formation in mouse and human. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous inactivation of this gene causes arrest of spermatogenesis, male sterility, glaucoma, and cataracts. Aging mice homozygous for an ENU-induced (null) allele show additional ocular phenotypes including an enlarged anterior chamber, lens extrusion, a flat iris, uveitis, and optic neuropathy. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 G T 8: 83,934,650 probably benign Het
Adgrv1 C A 13: 81,528,530 D1341Y probably damaging Het
Ahdc1 T C 4: 133,065,516 F1356S possibly damaging Het
BC027072 T G 17: 71,749,514 H1056P probably benign Het
Cdk13 A G 13: 17,721,297 probably benign Het
Cfhr1 A T 1: 139,557,511 S66T probably damaging Het
Cldn6 C A 17: 23,681,193 Q44K probably damaging Het
Cntnap5c T C 17: 58,305,555 V863A possibly damaging Het
Col6a4 T A 9: 106,067,144 K1044* probably null Het
Cyb561d1 A G 3: 108,199,267 V212A probably benign Het
Cyp1b1 A G 17: 79,713,846 S156P probably damaging Het
Dock7 G A 4: 99,016,704 H645Y probably damaging Het
Dpp3 T C 19: 4,914,654 N542D probably damaging Het
Fastkd3 C T 13: 68,591,928 probably benign Het
Galnt10 T A 11: 57,769,540 V268D probably damaging Het
Gm13078 A T 4: 143,728,052 T307S probably benign Het
Grb14 G T 2: 64,917,287 A10E probably damaging Het
Grin2c A G 11: 115,249,653 V1213A probably benign Het
Grip1 C T 10: 120,010,230 T570I probably damaging Het
Hif1an T C 19: 44,563,323 Y71H probably benign Het
Hsd17b11 T A 5: 104,003,206 I221L probably benign Het
Htra1 A T 7: 130,979,297 probably benign Het
Igfn1 T C 1: 135,963,853 E2308G possibly damaging Het
Mapk9 T A 11: 49,869,245 S129T probably damaging Het
Med22 T C 2: 26,910,379 T13A probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mtus1 A T 8: 40,993,517 L489Q probably damaging Het
Naprt G A 15: 75,893,632 P120S probably damaging Het
Nwd1 C T 8: 72,662,337 P172L probably damaging Het
Ogfod2 A G 5: 124,112,844 E62G probably null Het
Olfr1445 T C 19: 12,884,079 L66P probably damaging Het
Olfr1445 A G 19: 12,884,546 T222A probably damaging Het
Olfr211 A T 6: 116,494,400 S264C probably damaging Het
Palm A C 10: 79,819,493 T362P probably benign Het
Pcdh8 T C 14: 79,769,960 T388A probably benign Het
Pclo A G 5: 14,675,318 I1397V unknown Het
Per1 A G 11: 69,101,201 E127G probably damaging Het
Plekha1 T C 7: 130,900,623 V30A possibly damaging Het
Rab26 A G 17: 24,527,966 probably benign Het
Rasal2 T C 1: 157,157,180 D999G possibly damaging Het
Rfx5 C T 3: 94,956,355 T105I probably damaging Het
Rrp1b T C 17: 32,060,395 S677P probably damaging Het
Scaf4 G A 16: 90,249,694 P485S unknown Het
Scn5a A T 9: 119,539,640 M273K probably damaging Het
Sec22a C T 16: 35,361,556 probably null Het
Slc10a6 C A 5: 103,612,449 V227F possibly damaging Het
Slc39a3 C G 10: 81,033,731 E31Q probably benign Het
Spsb1 C T 4: 149,906,917 V65I probably benign Het
Trim8 C A 19: 46,515,093 S361R possibly damaging Het
Ucp1 T A 8: 83,295,307 M256K possibly damaging Het
Vmn1r46 A T 6: 89,976,964 D265V probably damaging Het
Zbtb5 T C 4: 44,993,787 I532M probably damaging Het
Other mutations in Tdrd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Tdrd7 APN 4 46010889 missense probably damaging 1.00
IGL01541:Tdrd7 APN 4 46018551 missense possibly damaging 0.90
IGL01901:Tdrd7 APN 4 45989225 splice site probably benign
IGL02812:Tdrd7 APN 4 45994406 missense probably benign 0.08
A5278:Tdrd7 UTSW 4 46007622 missense probably benign 0.01
R0049:Tdrd7 UTSW 4 45987582 missense probably damaging 1.00
R0049:Tdrd7 UTSW 4 45987582 missense probably damaging 1.00
R0389:Tdrd7 UTSW 4 46016987 missense probably benign 0.01
R0452:Tdrd7 UTSW 4 45965488 splice site probably benign
R0639:Tdrd7 UTSW 4 45989102 missense probably benign 0.00
R0925:Tdrd7 UTSW 4 46025758 missense probably damaging 1.00
R0944:Tdrd7 UTSW 4 46029762 missense probably benign 0.01
R1586:Tdrd7 UTSW 4 45994445 missense probably benign 0.39
R1770:Tdrd7 UTSW 4 45987681 splice site probably benign
R1945:Tdrd7 UTSW 4 45965474 missense probably benign 0.00
R4400:Tdrd7 UTSW 4 46005540 missense possibly damaging 0.87
R4457:Tdrd7 UTSW 4 46007526 missense probably benign 0.04
R4898:Tdrd7 UTSW 4 46005616 missense possibly damaging 0.94
R5152:Tdrd7 UTSW 4 46013191 missense probably damaging 1.00
R5197:Tdrd7 UTSW 4 46034350 missense probably damaging 1.00
R5326:Tdrd7 UTSW 4 46029757 missense probably benign 0.01
R5473:Tdrd7 UTSW 4 46020877 missense possibly damaging 0.95
R5524:Tdrd7 UTSW 4 46034301 missense probably benign 0.31
R5542:Tdrd7 UTSW 4 46029757 missense probably benign 0.01
R5554:Tdrd7 UTSW 4 46005358 missense possibly damaging 0.92
R5588:Tdrd7 UTSW 4 45992225 missense probably benign 0.18
R5776:Tdrd7 UTSW 4 46005689 missense probably benign 0.00
R5786:Tdrd7 UTSW 4 45989082 missense probably benign 0.09
R6063:Tdrd7 UTSW 4 46005486 missense probably benign 0.00
R6340:Tdrd7 UTSW 4 45994517 missense probably damaging 0.99
R7130:Tdrd7 UTSW 4 46029693 missense probably damaging 1.00
R7369:Tdrd7 UTSW 4 46013239 missense possibly damaging 0.79
R7470:Tdrd7 UTSW 4 45990144 missense probably benign 0.32
R7876:Tdrd7 UTSW 4 46025684 missense probably benign
R7959:Tdrd7 UTSW 4 46025684 missense probably benign
R7999:Tdrd7 UTSW 4 46010902 critical splice donor site probably null
R8042:Tdrd7 UTSW 4 45987516 missense possibly damaging 0.71
R8058:Tdrd7 UTSW 4 46034309 missense probably benign 0.34
X0063:Tdrd7 UTSW 4 45992268 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGGCTGGCGTTTAGTCTTGC -3'
(R):5'- CTGATCTCAGGAGACAGTACTCCACC -3'

Sequencing Primer
(F):5'- aactgctactctgccctaac -3'
(R):5'- CATACCTTGCAGTGGAAGTAGTC -3'
Posted On2013-07-30