Incidental Mutation 'R7895:Kmt2c'
ID609589
Institutional Source Beutler Lab
Gene Symbol Kmt2c
Ensembl Gene ENSMUSG00000038056
Gene Namelysine (K)-specific methyltransferase 2C
SynonymsMll3, E330008K23Rik, HALR
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7895 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location25271798-25498783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25373176 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 701 (S701P)
Ref Sequence ENSEMBL: ENSMUSP00000133304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045291] [ENSMUST00000173073] [ENSMUST00000173174]
Predicted Effect probably benign
Transcript: ENSMUST00000045291
AA Change: S702P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000043874
Gene: ENSMUSG00000038056
AA Change: S702P

DomainStartEndE-ValueType
low complexity region 9 32 N/A INTRINSIC
AT_hook 34 46 9.68e-1 SMART
low complexity region 73 87 N/A INTRINSIC
PHD 283 330 2.56e-2 SMART
C1 329 384 5.45e-1 SMART
PHD 342 388 4.19e-7 SMART
RING 343 387 1.45e-1 SMART
PHD 389 435 4.77e-11 SMART
RING 390 434 1.46e0 SMART
PHD 465 517 8.25e-6 SMART
low complexity region 776 789 N/A INTRINSIC
AT_hook 898 910 1.41e2 SMART
PHD 953 1002 2.89e-10 SMART
RING 954 1001 4.74e0 SMART
C1 994 1045 8.38e-2 SMART
PHD 1003 1049 1.05e-12 SMART
PHD 1080 1131 2.08e-2 SMART
low complexity region 1189 1201 N/A INTRINSIC
low complexity region 1337 1348 N/A INTRINSIC
low complexity region 1394 1406 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1520 1539 N/A INTRINSIC
low complexity region 1557 1570 N/A INTRINSIC
HMG 1639 1703 2.64e-3 SMART
low complexity region 1708 1724 N/A INTRINSIC
coiled coil region 1745 1789 N/A INTRINSIC
low complexity region 1847 1860 N/A INTRINSIC
low complexity region 1864 1891 N/A INTRINSIC
internal_repeat_3 1893 2084 1.27e-14 PROSPERO
internal_repeat_3 2123 2306 1.27e-14 PROSPERO
low complexity region 2336 2348 N/A INTRINSIC
low complexity region 2375 2394 N/A INTRINSIC
low complexity region 2427 2440 N/A INTRINSIC
low complexity region 2516 2527 N/A INTRINSIC
low complexity region 2696 2720 N/A INTRINSIC
low complexity region 2723 2742 N/A INTRINSIC
low complexity region 2930 2943 N/A INTRINSIC
coiled coil region 3048 3075 N/A INTRINSIC
low complexity region 3156 3165 N/A INTRINSIC
low complexity region 3173 3195 N/A INTRINSIC
coiled coil region 3226 3270 N/A INTRINSIC
low complexity region 3277 3290 N/A INTRINSIC
coiled coil region 3389 3427 N/A INTRINSIC
low complexity region 3460 3486 N/A INTRINSIC
low complexity region 3597 3611 N/A INTRINSIC
low complexity region 3649 3667 N/A INTRINSIC
low complexity region 3769 3783 N/A INTRINSIC
low complexity region 3822 3827 N/A INTRINSIC
low complexity region 3860 3869 N/A INTRINSIC
low complexity region 3887 3904 N/A INTRINSIC
low complexity region 3994 4009 N/A INTRINSIC
low complexity region 4015 4038 N/A INTRINSIC
low complexity region 4293 4309 N/A INTRINSIC
low complexity region 4412 4419 N/A INTRINSIC
PHD 4454 4500 2.94e-2 SMART
RING 4455 4499 8.1e0 SMART
FYRN 4554 4597 1.18e-21 SMART
FYRC 4603 4690 4.54e-32 SMART
SET 4764 4886 3.17e-34 SMART
PostSET 4888 4904 1.82e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173073
AA Change: S702P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134442
Gene: ENSMUSG00000038056
AA Change: S702P

DomainStartEndE-ValueType
low complexity region 9 32 N/A INTRINSIC
AT_hook 34 46 9.68e-1 SMART
low complexity region 73 87 N/A INTRINSIC
PHD 283 330 2.56e-2 SMART
C1 329 384 5.45e-1 SMART
PHD 342 388 4.19e-7 SMART
RING 343 387 1.45e-1 SMART
PHD 389 435 4.77e-11 SMART
RING 390 434 1.46e0 SMART
PHD 465 517 8.25e-6 SMART
low complexity region 776 789 N/A INTRINSIC
AT_hook 858 870 1.41e2 SMART
PHD 913 962 2.89e-10 SMART
RING 914 961 4.74e0 SMART
C1 954 1005 8.38e-2 SMART
PHD 963 1009 1.05e-12 SMART
PHD 1040 1091 2.08e-2 SMART
low complexity region 1149 1161 N/A INTRINSIC
low complexity region 1297 1308 N/A INTRINSIC
low complexity region 1354 1366 N/A INTRINSIC
low complexity region 1445 1464 N/A INTRINSIC
low complexity region 1482 1495 N/A INTRINSIC
HMG 1564 1628 2.64e-3 SMART
low complexity region 1633 1649 N/A INTRINSIC
coiled coil region 1670 1714 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173174
AA Change: S701P

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133304
Gene: ENSMUSG00000038056
AA Change: S701P

DomainStartEndE-ValueType
low complexity region 9 32 N/A INTRINSIC
AT_hook 34 46 9.68e-1 SMART
low complexity region 73 87 N/A INTRINSIC
PHD 283 330 2.56e-2 SMART
PHD 342 388 4.19e-7 SMART
RING 343 387 1.45e-1 SMART
PHD 389 435 4.77e-11 SMART
RING 390 434 1.46e0 SMART
PHD 465 517 8.25e-6 SMART
low complexity region 775 788 N/A INTRINSIC
Meta Mutation Damage Score 0.0856 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (92/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a nuclear protein with an AT hook DNA-binding domain, a DHHC-type zinc finger, six PHD-type zinc fingers, a SET domain, a post-SET domain and a RING-type zinc finger. This protein is a member of the ASC-2/NCOA6 complex (ASCOM), which possesses histone methylation activity and is involved in transcriptional coactivation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display partial embryonic lethality, delayed eyelid opening, postnatal growth retardation, impaired fertility in both sexes, and decreased proliferation of cultured mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,059,510 S143T probably benign Het
9030624G23Rik A T 12: 24,044,723 M149K unknown Het
Agpat3 T A 10: 78,283,200 I187F probably benign Het
Ahcyl1 C T 3: 107,669,151 A332T probably damaging Het
Aldh3b3 A G 19: 3,964,871 I123V possibly damaging Het
Ap5z1 T A 5: 142,470,558 probably null Het
Apob A T 12: 8,011,933 I3472F probably benign Het
Arhgef33 C T 17: 80,373,485 P685S probably benign Het
Arhgef4 T C 1: 34,806,397 I130T probably damaging Het
Arnt2 A T 7: 84,305,198 F263I probably benign Het
Bbof1 A G 12: 84,419,989 R177G probably damaging Het
Bbs2 C A 8: 94,081,136 G372W probably damaging Het
Blmh T A 11: 76,945,895 probably null Het
Ccdc30 A T 4: 119,352,713 probably null Het
Cdca7l G T 12: 117,873,732 L219F probably damaging Het
Cenpu C A 8: 46,562,464 A138E probably benign Het
Cfap65 T A 1: 74,933,162 T13S probably benign Het
Clasp2 A G 9: 113,903,948 M951V probably benign Het
Clca4a A G 3: 144,968,405 S190P probably benign Het
Clcn4 A G 7: 7,295,168 V74A probably benign Het
Cntln C T 4: 85,063,324 T913M possibly damaging Het
Cntnap4 T A 8: 112,752,197 V185E probably damaging Het
Col26a1 C T 5: 136,748,177 probably null Het
Ctcf A T 8: 105,664,058 Q99L possibly damaging Het
Dgke T C 11: 89,040,856 Q524R probably damaging Het
Dhrs7 A T 12: 72,652,460 probably null Het
Dnah7b T C 1: 46,249,950 Y2969H probably damaging Het
Dync1h1 T G 12: 110,616,457 I358S probably damaging Het
Efcab3 A C 11: 105,117,324 D410A probably benign Het
Emilin2 T C 17: 71,273,913 D606G probably benign Het
Ermard C T 17: 15,063,613 T622I possibly damaging Het
Exo1 A G 1: 175,900,996 D542G probably benign Het
Fgd5 A T 6: 91,987,281 D165V probably benign Het
Gdap1 T C 1: 17,161,144 W238R probably damaging Het
Gm11096 T G 17: 81,441,899 I7M unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm436 A T 4: 144,670,343 I273K possibly damaging Het
Gmppb A T 9: 108,050,571 M175L probably benign Het
Gorasp2 G A 2: 70,684,098 S273N probably benign Het
Gtf3c1 T C 7: 125,672,822 M642V possibly damaging Het
Hmx2 T A 7: 131,555,871 L238Q probably damaging Het
Kif13b A G 14: 64,736,149 D316G probably damaging Het
Lama4 T A 10: 39,088,329 N1332K probably damaging Het
Lrp2 T C 2: 69,458,479 D3681G probably damaging Het
Maml3 G T 3: 51,697,722 P722Q probably damaging Het
Mier2 C A 10: 79,541,885 probably benign Het
Ms4a15 A T 19: 10,979,330 probably null Het
Msh5 T C 17: 35,044,379 M158V probably benign Het
Nova2 A T 7: 18,942,345 K136I Het
Npm1 A T 11: 33,156,001 probably null Het
Nr4a3 T A 4: 48,051,390 M48K probably benign Het
Nrap T G 19: 56,354,152 T806P probably benign Het
Ntf3 G A 6: 126,102,240 T101M probably benign Het
Olfr169 G A 16: 19,566,722 R54* probably null Het
Paxbp1 T A 16: 91,025,278 D648V probably damaging Het
Pcdhb18 T A 18: 37,490,467 D283E probably benign Het
Phrf1 C A 7: 141,259,375 Q828K unknown Het
Pigq A T 17: 25,937,325 I43N probably benign Het
Pou6f2 G T 13: 18,125,448 T542K Het
Ppfibp2 T A 7: 107,721,317 probably null Het
Rab1b A T 19: 5,100,496 M163K probably benign Het
Ralgapa1 A G 12: 55,747,149 M567T probably benign Het
Reck T C 4: 43,890,970 V36A probably benign Het
Resp18 C T 1: 75,278,202 D36N probably null Het
Rint1 A C 5: 23,800,722 H134P probably damaging Het
Rps19 A T 7: 24,888,339 K77M possibly damaging Het
Sec24b A T 3: 129,995,949 S808T probably benign Het
Sema4c A C 1: 36,553,118 V216G probably damaging Het
Sept10 T A 10: 59,181,049 T218S probably benign Het
Sept3 A T 15: 82,285,819 H182L probably benign Het
Sipa1 A G 19: 5,652,662 S836P probably benign Het
Slc9a5 A G 8: 105,363,366 K652R probably damaging Het
Slco5a1 T A 1: 12,989,703 I265F possibly damaging Het
Snapc5 T A 9: 64,179,332 M1K probably null Het
Snx5 T A 2: 144,253,820 D307V possibly damaging Het
Srebf2 A T 15: 82,177,240 M381L probably benign Het
Ssh2 G C 11: 77,454,626 E1146Q probably benign Het
Suco A T 1: 161,845,368 probably null Het
Tanc2 T A 11: 105,921,825 L1365Q probably damaging Het
Tas1r3 A G 4: 155,862,548 L200P probably damaging Het
Thbs2 T G 17: 14,676,221 D802A probably damaging Het
Trav3-1 G A 14: 52,581,093 V75M probably benign Het
Trim9 G A 12: 70,255,187 P559L probably benign Het
Trpc6 G A 9: 8,655,218 G683D probably damaging Het
Unc5b C A 10: 60,779,730 V164L possibly damaging Het
Usf3 A T 16: 44,216,202 R348S possibly damaging Het
Vmn1r236 T C 17: 21,287,466 V282A possibly damaging Het
Vmn2r1 A G 3: 64,089,709 E262G possibly damaging Het
Xirp2 A G 2: 67,509,497 E694G probably damaging Het
Xpo4 T A 14: 57,602,591 H572L probably benign Het
Zfhx4 A G 3: 5,242,199 T162A probably benign Het
Zfp110 T A 7: 12,837,093 H59Q possibly damaging Het
Other mutations in Kmt2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Kmt2c APN 5 25281261 missense probably damaging 0.99
IGL00694:Kmt2c APN 5 25293161 missense probably damaging 0.99
IGL00780:Kmt2c APN 5 25311051 missense probably benign 0.00
IGL00811:Kmt2c APN 5 25374533 missense possibly damaging 0.75
IGL00885:Kmt2c APN 5 25409171 missense possibly damaging 0.80
IGL00948:Kmt2c APN 5 25377161 missense probably benign 0.08
IGL00959:Kmt2c APN 5 25276229 missense probably damaging 1.00
IGL01022:Kmt2c APN 5 25302701 unclassified probably benign
IGL01146:Kmt2c APN 5 25308512 missense probably damaging 0.96
IGL01154:Kmt2c APN 5 25284399 missense probably damaging 1.00
IGL01434:Kmt2c APN 5 25409308 missense probably damaging 1.00
IGL01464:Kmt2c APN 5 25352244 missense possibly damaging 0.90
IGL01525:Kmt2c APN 5 25329441 splice site probably benign
IGL01530:Kmt2c APN 5 25313500 missense probably benign 0.08
IGL01550:Kmt2c APN 5 25281276 missense probably damaging 1.00
IGL01598:Kmt2c APN 5 25273666 makesense probably null
IGL01598:Kmt2c APN 5 25354771 missense probably damaging 1.00
IGL01608:Kmt2c APN 5 25354811 missense probably damaging 0.97
IGL01663:Kmt2c APN 5 25310670 missense probably damaging 1.00
IGL01707:Kmt2c APN 5 25300098 missense probably damaging 1.00
IGL01714:Kmt2c APN 5 25313400 missense probably benign
IGL01784:Kmt2c APN 5 25313526 missense probably damaging 1.00
IGL01813:Kmt2c APN 5 25290804 missense possibly damaging 0.82
IGL01825:Kmt2c APN 5 25310596 missense probably damaging 1.00
IGL01834:Kmt2c APN 5 25395455 missense probably benign 0.05
IGL02072:Kmt2c APN 5 25405432 missense possibly damaging 0.96
IGL02159:Kmt2c APN 5 25311343 missense probably benign 0.18
IGL02303:Kmt2c APN 5 25310157 missense probably damaging 0.96
IGL02417:Kmt2c APN 5 25373020 missense probably benign
IGL02578:Kmt2c APN 5 25366200 intron probably benign
IGL02811:Kmt2c APN 5 25315028 nonsense probably null
IGL02943:Kmt2c APN 5 25290823 missense probably damaging 1.00
IGL03000:Kmt2c APN 5 25284172 missense probably damaging 1.00
IGL03040:Kmt2c APN 5 25310352 missense probably benign
IGL03076:Kmt2c APN 5 25299151 nonsense probably null
IGL03088:Kmt2c APN 5 25299804 missense probably damaging 0.99
IGL03131:Kmt2c APN 5 25315361 missense probably benign 0.00
FR4304:Kmt2c UTSW 5 25315766 small insertion probably benign
FR4976:Kmt2c UTSW 5 25315763 small insertion probably benign
PIT4520001:Kmt2c UTSW 5 25315666 missense probably benign 0.12
PIT4585001:Kmt2c UTSW 5 25315106 missense probably benign 0.21
R0313:Kmt2c UTSW 5 25344930 missense probably damaging 1.00
R0374:Kmt2c UTSW 5 25309708 missense probably damaging 1.00
R0411:Kmt2c UTSW 5 25375957 missense probably damaging 1.00
R0422:Kmt2c UTSW 5 25315664 missense probably benign
R0453:Kmt2c UTSW 5 25354747 missense probably damaging 1.00
R0616:Kmt2c UTSW 5 25299252 missense probably benign
R0619:Kmt2c UTSW 5 25298916 missense probably benign 0.21
R0671:Kmt2c UTSW 5 25404365 missense probably damaging 1.00
R0736:Kmt2c UTSW 5 25295434 missense probably benign
R0745:Kmt2c UTSW 5 25359698 splice site probably null
R0760:Kmt2c UTSW 5 25353317 missense possibly damaging 0.68
R0784:Kmt2c UTSW 5 25310895 missense probably benign 0.00
R0882:Kmt2c UTSW 5 25295607 missense possibly damaging 0.90
R0893:Kmt2c UTSW 5 25351270 splice site probably benign
R0942:Kmt2c UTSW 5 25315303 missense probably benign 0.10
R1110:Kmt2c UTSW 5 25314362 missense probably benign 0.01
R1137:Kmt2c UTSW 5 25310983 missense possibly damaging 0.80
R1255:Kmt2c UTSW 5 25351153 missense probably damaging 1.00
R1300:Kmt2c UTSW 5 25405454 missense probably damaging 0.99
R1497:Kmt2c UTSW 5 25314515 missense possibly damaging 0.80
R1594:Kmt2c UTSW 5 25314878 missense probably benign 0.01
R1611:Kmt2c UTSW 5 25359311 critical splice donor site probably null
R1617:Kmt2c UTSW 5 25375927 missense probably benign 0.01
R1720:Kmt2c UTSW 5 25299184 missense probably benign 0.05
R1723:Kmt2c UTSW 5 25315005 missense probably damaging 1.00
R1724:Kmt2c UTSW 5 25315005 missense probably damaging 1.00
R1726:Kmt2c UTSW 5 25315005 missense probably damaging 1.00
R1736:Kmt2c UTSW 5 25290527 missense probably damaging 1.00
R1778:Kmt2c UTSW 5 25372974 missense probably benign 0.02
R1809:Kmt2c UTSW 5 25284192 missense probably damaging 1.00
R1845:Kmt2c UTSW 5 25373436 missense probably benign 0.45
R1895:Kmt2c UTSW 5 25315154 missense probably benign 0.34
R1946:Kmt2c UTSW 5 25315154 missense probably benign 0.34
R1989:Kmt2c UTSW 5 25498544 missense possibly damaging 0.93
R2039:Kmt2c UTSW 5 25329040 missense possibly damaging 0.53
R2049:Kmt2c UTSW 5 25285079 missense probably damaging 1.00
R2079:Kmt2c UTSW 5 25352280 missense possibly damaging 0.82
R2080:Kmt2c UTSW 5 25354717 missense probably damaging 1.00
R2107:Kmt2c UTSW 5 25309824 missense probably benign 0.01
R2186:Kmt2c UTSW 5 25287112 missense probably damaging 1.00
R2395:Kmt2c UTSW 5 25315152 missense probably benign
R2983:Kmt2c UTSW 5 25315757 small deletion probably benign
R3109:Kmt2c UTSW 5 25275735 missense probably damaging 1.00
R3500:Kmt2c UTSW 5 25299479 missense probably benign 0.02
R3738:Kmt2c UTSW 5 25405383 missense probably benign 0.41
R3809:Kmt2c UTSW 5 25409138 missense possibly damaging 0.87
R4088:Kmt2c UTSW 5 25287713 missense probably benign
R4107:Kmt2c UTSW 5 25298920 missense possibly damaging 0.51
R4212:Kmt2c UTSW 5 25347359 critical splice donor site probably null
R4376:Kmt2c UTSW 5 25315326 missense probably benign 0.00
R4377:Kmt2c UTSW 5 25315326 missense probably benign 0.00
R4383:Kmt2c UTSW 5 25351062 missense possibly damaging 0.77
R4435:Kmt2c UTSW 5 25314877 missense possibly damaging 0.63
R4456:Kmt2c UTSW 5 25310212 missense probably benign
R4461:Kmt2c UTSW 5 25299876 missense probably benign 0.00
R4519:Kmt2c UTSW 5 25363477 missense probably damaging 1.00
R4550:Kmt2c UTSW 5 25300174 missense probably damaging 1.00
R4557:Kmt2c UTSW 5 25300315 missense probably damaging 1.00
R4610:Kmt2c UTSW 5 25354384 missense probably damaging 1.00
R4671:Kmt2c UTSW 5 25366177 missense probably damaging 1.00
R4704:Kmt2c UTSW 5 25314027 nonsense probably null
R4781:Kmt2c UTSW 5 25443825 missense probably damaging 1.00
R4844:Kmt2c UTSW 5 25315113 missense probably benign
R4855:Kmt2c UTSW 5 25314557 missense probably benign 0.00
R4919:Kmt2c UTSW 5 25314395 missense possibly damaging 0.80
R4971:Kmt2c UTSW 5 25310872 missense probably benign 0.00
R4983:Kmt2c UTSW 5 25295511 missense possibly damaging 0.51
R5012:Kmt2c UTSW 5 25299712 nonsense probably null
R5033:Kmt2c UTSW 5 25314708 missense probably benign 0.03
R5093:Kmt2c UTSW 5 25409207 missense probably benign 0.17
R5125:Kmt2c UTSW 5 25284381 missense probably damaging 0.99
R5231:Kmt2c UTSW 5 25315473 missense possibly damaging 0.89
R5254:Kmt2c UTSW 5 25314594 missense probably benign 0.01
R5396:Kmt2c UTSW 5 25294734 splice site probably null
R5415:Kmt2c UTSW 5 25314701 missense probably benign 0.21
R5523:Kmt2c UTSW 5 25299339 missense probably benign 0.00
R5554:Kmt2c UTSW 5 25294610 missense probably damaging 1.00
R5701:Kmt2c UTSW 5 25314017 missense probably benign 0.16
R5762:Kmt2c UTSW 5 25310457 missense probably benign 0.01
R5819:Kmt2c UTSW 5 25409132 critical splice donor site probably null
R5838:Kmt2c UTSW 5 25284471 missense probably damaging 1.00
R5912:Kmt2c UTSW 5 25347469 missense possibly damaging 0.80
R5951:Kmt2c UTSW 5 25330803 missense probably benign 0.15
R5988:Kmt2c UTSW 5 25311120 missense probably benign 0.02
R5999:Kmt2c UTSW 5 25284205 missense probably damaging 1.00
R6104:Kmt2c UTSW 5 25299129 missense probably benign
R6254:Kmt2c UTSW 5 25349874 missense possibly damaging 0.94
R6311:Kmt2c UTSW 5 25443818 critical splice donor site probably null
R6329:Kmt2c UTSW 5 25315602 missense probably benign 0.01
R6347:Kmt2c UTSW 5 25310835 missense possibly damaging 0.54
R6364:Kmt2c UTSW 5 25309636 missense probably null 0.99
R6379:Kmt2c UTSW 5 25359341 missense probably damaging 1.00
R6588:Kmt2c UTSW 5 25323789 missense probably damaging 0.99
R6628:Kmt2c UTSW 5 25298928 missense probably benign
R6733:Kmt2c UTSW 5 25409293 missense probably damaging 1.00
R6787:Kmt2c UTSW 5 25275739 splice site probably null
R6816:Kmt2c UTSW 5 25405532 splice site probably null
R6862:Kmt2c UTSW 5 25310517 missense probably damaging 1.00
R7150:Kmt2c UTSW 5 25300362 missense possibly damaging 0.89
R7220:Kmt2c UTSW 5 25344925 missense probably damaging 1.00
R7250:Kmt2c UTSW 5 25299491 missense probably damaging 1.00
R7250:Kmt2c UTSW 5 25309807 missense probably benign 0.00
R7402:Kmt2c UTSW 5 25395420 missense probably damaging 1.00
R7465:Kmt2c UTSW 5 25302849 missense probably damaging 1.00
R7467:Kmt2c UTSW 5 25308532 missense probably damaging 1.00
R7491:Kmt2c UTSW 5 25284564 missense probably damaging 0.99
R7549:Kmt2c UTSW 5 25414970 missense possibly damaging 0.95
R7637:Kmt2c UTSW 5 25315095 missense probably damaging 1.00
R7652:Kmt2c UTSW 5 25315719 missense probably benign 0.01
R7714:Kmt2c UTSW 5 25375366 missense probably benign
R7838:Kmt2c UTSW 5 25294699 missense possibly damaging 0.57
R7891:Kmt2c UTSW 5 25300111 missense probably damaging 1.00
R7892:Kmt2c UTSW 5 25299816 missense probably benign 0.18
R7960:Kmt2c UTSW 5 25315196 missense probably benign 0.01
R7974:Kmt2c UTSW 5 25300563 missense probably damaging 1.00
R7978:Kmt2c UTSW 5 25359678 missense probably benign 0.00
R8011:Kmt2c UTSW 5 25351234 missense probably damaging 0.99
R8021:Kmt2c UTSW 5 25287119 missense possibly damaging 0.88
R8022:Kmt2c UTSW 5 25281680 missense possibly damaging 0.83
R8079:Kmt2c UTSW 5 25302732 missense probably damaging 0.98
R8087:Kmt2c UTSW 5 25329252 missense probably damaging 1.00
R8109:Kmt2c UTSW 5 25281384 missense probably damaging 1.00
R8161:Kmt2c UTSW 5 25374564 missense probably benign 0.00
R8169:Kmt2c UTSW 5 25354687 missense probably damaging 1.00
R8206:Kmt2c UTSW 5 25314539 missense probably damaging 0.98
R8218:Kmt2c UTSW 5 25283106 missense probably damaging 1.00
R8223:Kmt2c UTSW 5 25324218 missense possibly damaging 0.89
R8260:Kmt2c UTSW 5 25405516 missense possibly damaging 0.87
R8330:Kmt2c UTSW 5 25304694 missense probably null 1.00
R8355:Kmt2c UTSW 5 25354501 critical splice acceptor site probably null
R8455:Kmt2c UTSW 5 25354501 critical splice acceptor site probably null
R8508:Kmt2c UTSW 5 25314122 missense probably benign 0.34
R8885:Kmt2c UTSW 5 25315079 missense probably benign 0.34
R8907:Kmt2c UTSW 5 25309611 missense probably damaging 1.00
R8924:Kmt2c UTSW 5 25298887 missense probably benign
RF001:Kmt2c UTSW 5 25315775 small insertion probably benign
RF006:Kmt2c UTSW 5 25315772 small insertion probably benign
RF011:Kmt2c UTSW 5 25338459 missense probably damaging 1.00
RF041:Kmt2c UTSW 5 25315775 small insertion probably benign
RF047:Kmt2c UTSW 5 25315760 small insertion probably benign
RF051:Kmt2c UTSW 5 25313479 unclassified probably benign
RF055:Kmt2c UTSW 5 25315772 small insertion probably benign
RF059:Kmt2c UTSW 5 25313479 unclassified probably benign
RF063:Kmt2c UTSW 5 25315764 small insertion probably benign
X0024:Kmt2c UTSW 5 25405485 missense probably benign 0.26
X0027:Kmt2c UTSW 5 25330887 missense possibly damaging 0.90
Z1176:Kmt2c UTSW 5 25354413 missense probably damaging 1.00
Z1177:Kmt2c UTSW 5 25295397 critical splice donor site probably null
Z1177:Kmt2c UTSW 5 25300003 missense probably benign 0.00
Z1177:Kmt2c UTSW 5 25366197 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATGTTGATTCTTCCTCAGCTGG -3'
(R):5'- TCTAAAGGGCGACATGTTTGTG -3'

Sequencing Primer
(F):5'- CAGCTGGTAACTCTACATATTTGTC -3'
(R):5'- CGACATGTTTGTGAGGAAGATC -3'
Posted On2019-12-20