Incidental Mutation 'R7895:Clcn4'
ID609593
Institutional Source Beutler Lab
Gene Symbol Clcn4
Ensembl Gene ENSMUSG00000000605
Gene Namechloride channel, voltage-sensitive 4
SynonymsClc4-2, Clcn4-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7895 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location7282309-7300851 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7295168 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 74 (V74A)
Ref Sequence ENSEMBL: ENSMUSP00000000619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000619] [ENSMUST00000209916] [ENSMUST00000210061] [ENSMUST00000210362] [ENSMUST00000210594] [ENSMUST00000211574]
Predicted Effect probably benign
Transcript: ENSMUST00000000619
AA Change: V74A

PolyPhen 2 Score 0.263 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000000619
Gene: ENSMUSG00000000605
AA Change: V74A

DomainStartEndE-ValueType
transmembrane domain 57 79 N/A INTRINSIC
Pfam:Voltage_CLC 149 552 2.7e-111 PFAM
CBS 596 646 1.07e-1 SMART
CBS 687 734 4.92e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209916
Predicted Effect probably benign
Transcript: ENSMUST00000210061
AA Change: V74A

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000210362
Predicted Effect probably benign
Transcript: ENSMUST00000210594
AA Change: V14A

PolyPhen 2 Score 0.263 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000211574
Meta Mutation Damage Score 0.4298 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (92/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. Chloride channel 4 has an evolutionary conserved CpG island and is conserved in both mouse and hamster. This gene is mapped in close proximity to APXL (Apical protein Xenopus laevis-like) and OA1 (Ocular albinism type I), which are both located on the human X chromosome at band p22.3. The physiological role of chloride channel 4 remains unknown but may contribute to the pathogenesis of neuronal disorders. Alternate splicing results in two transcript variants that encode different proteins. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,059,510 S143T probably benign Het
9030624G23Rik A T 12: 24,044,723 M149K unknown Het
Agpat3 T A 10: 78,283,200 I187F probably benign Het
Ahcyl1 C T 3: 107,669,151 A332T probably damaging Het
Aldh3b3 A G 19: 3,964,871 I123V possibly damaging Het
Ap5z1 T A 5: 142,470,558 probably null Het
Apob A T 12: 8,011,933 I3472F probably benign Het
Arhgef33 C T 17: 80,373,485 P685S probably benign Het
Arhgef4 T C 1: 34,806,397 I130T probably damaging Het
Arnt2 A T 7: 84,305,198 F263I probably benign Het
Bbof1 A G 12: 84,419,989 R177G probably damaging Het
Bbs2 C A 8: 94,081,136 G372W probably damaging Het
Blmh T A 11: 76,945,895 probably null Het
Ccdc30 A T 4: 119,352,713 probably null Het
Cdca7l G T 12: 117,873,732 L219F probably damaging Het
Cenpu C A 8: 46,562,464 A138E probably benign Het
Cfap65 T A 1: 74,933,162 T13S probably benign Het
Clasp2 A G 9: 113,903,948 M951V probably benign Het
Clca4a A G 3: 144,968,405 S190P probably benign Het
Cntln C T 4: 85,063,324 T913M possibly damaging Het
Cntnap4 T A 8: 112,752,197 V185E probably damaging Het
Col26a1 C T 5: 136,748,177 probably null Het
Ctcf A T 8: 105,664,058 Q99L possibly damaging Het
Dgke T C 11: 89,040,856 Q524R probably damaging Het
Dhrs7 A T 12: 72,652,460 probably null Het
Dnah7b T C 1: 46,249,950 Y2969H probably damaging Het
Dync1h1 T G 12: 110,616,457 I358S probably damaging Het
Efcab3 A C 11: 105,117,324 D410A probably benign Het
Emilin2 T C 17: 71,273,913 D606G probably benign Het
Ermard C T 17: 15,063,613 T622I possibly damaging Het
Exo1 A G 1: 175,900,996 D542G probably benign Het
Fgd5 A T 6: 91,987,281 D165V probably benign Het
Gdap1 T C 1: 17,161,144 W238R probably damaging Het
Gm11096 T G 17: 81,441,899 I7M unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm436 A T 4: 144,670,343 I273K possibly damaging Het
Gmppb A T 9: 108,050,571 M175L probably benign Het
Gorasp2 G A 2: 70,684,098 S273N probably benign Het
Gtf3c1 T C 7: 125,672,822 M642V possibly damaging Het
Hmx2 T A 7: 131,555,871 L238Q probably damaging Het
Kif13b A G 14: 64,736,149 D316G probably damaging Het
Kmt2c A G 5: 25,373,176 S701P possibly damaging Het
Lama4 T A 10: 39,088,329 N1332K probably damaging Het
Lrp2 T C 2: 69,458,479 D3681G probably damaging Het
Maml3 G T 3: 51,697,722 P722Q probably damaging Het
Mier2 C A 10: 79,541,885 probably benign Het
Ms4a15 A T 19: 10,979,330 probably null Het
Msh5 T C 17: 35,044,379 M158V probably benign Het
Nova2 A T 7: 18,942,345 K136I Het
Npm1 A T 11: 33,156,001 probably null Het
Nr4a3 T A 4: 48,051,390 M48K probably benign Het
Nrap T G 19: 56,354,152 T806P probably benign Het
Ntf3 G A 6: 126,102,240 T101M probably benign Het
Olfr169 G A 16: 19,566,722 R54* probably null Het
Paxbp1 T A 16: 91,025,278 D648V probably damaging Het
Pcdhb18 T A 18: 37,490,467 D283E probably benign Het
Phrf1 C A 7: 141,259,375 Q828K unknown Het
Pigq A T 17: 25,937,325 I43N probably benign Het
Pou6f2 G T 13: 18,125,448 T542K Het
Ppfibp2 T A 7: 107,721,317 probably null Het
Rab1b A T 19: 5,100,496 M163K probably benign Het
Ralgapa1 A G 12: 55,747,149 M567T probably benign Het
Reck T C 4: 43,890,970 V36A probably benign Het
Resp18 C T 1: 75,278,202 D36N probably null Het
Rint1 A C 5: 23,800,722 H134P probably damaging Het
Rps19 A T 7: 24,888,339 K77M possibly damaging Het
Sec24b A T 3: 129,995,949 S808T probably benign Het
Sema4c A C 1: 36,553,118 V216G probably damaging Het
Sept10 T A 10: 59,181,049 T218S probably benign Het
Sept3 A T 15: 82,285,819 H182L probably benign Het
Sipa1 A G 19: 5,652,662 S836P probably benign Het
Slc9a5 A G 8: 105,363,366 K652R probably damaging Het
Slco5a1 T A 1: 12,989,703 I265F possibly damaging Het
Snapc5 T A 9: 64,179,332 M1K probably null Het
Snx5 T A 2: 144,253,820 D307V possibly damaging Het
Srebf2 A T 15: 82,177,240 M381L probably benign Het
Ssh2 G C 11: 77,454,626 E1146Q probably benign Het
Suco A T 1: 161,845,368 probably null Het
Tanc2 T A 11: 105,921,825 L1365Q probably damaging Het
Tas1r3 A G 4: 155,862,548 L200P probably damaging Het
Thbs2 T G 17: 14,676,221 D802A probably damaging Het
Trav3-1 G A 14: 52,581,093 V75M probably benign Het
Trim9 G A 12: 70,255,187 P559L probably benign Het
Trpc6 G A 9: 8,655,218 G683D probably damaging Het
Unc5b C A 10: 60,779,730 V164L possibly damaging Het
Usf3 A T 16: 44,216,202 R348S possibly damaging Het
Vmn1r236 T C 17: 21,287,466 V282A possibly damaging Het
Vmn2r1 A G 3: 64,089,709 E262G possibly damaging Het
Xirp2 A G 2: 67,509,497 E694G probably damaging Het
Xpo4 T A 14: 57,602,591 H572L probably benign Het
Zfhx4 A G 3: 5,242,199 T162A probably benign Het
Zfp110 T A 7: 12,837,093 H59Q possibly damaging Het
Other mutations in Clcn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Clcn4 APN 7 7287673 missense probably damaging 0.99
IGL01090:Clcn4 APN 7 7294036 missense probably benign 0.01
IGL01650:Clcn4 APN 7 7284281 splice site probably benign
IGL02404:Clcn4 APN 7 7287858 missense probably benign 0.04
IGL02493:Clcn4 APN 7 7284244 missense probably damaging 1.00
IGL02556:Clcn4 APN 7 7296066 missense probably benign
IGL02661:Clcn4 APN 7 7291731 splice site probably null
IGL02816:Clcn4 APN 7 7295088 missense probably damaging 1.00
IGL02882:Clcn4 APN 7 7290465 missense probably damaging 1.00
IGL03205:Clcn4 APN 7 7290420 missense probably damaging 1.00
IGL03289:Clcn4 APN 7 7284258 missense probably damaging 1.00
Delipidated UTSW 7 7293061 missense probably damaging 1.00
R0183:Clcn4 UTSW 7 7295091 nonsense probably null
R0379:Clcn4 UTSW 7 7296792 missense probably damaging 0.99
R0555:Clcn4 UTSW 7 7290504 missense possibly damaging 0.65
R0890:Clcn4 UTSW 7 7288965 missense possibly damaging 0.89
R1463:Clcn4 UTSW 7 7296764 nonsense probably null
R1549:Clcn4 UTSW 7 7291682 missense probably damaging 1.00
R1563:Clcn4 UTSW 7 7293982 missense probably damaging 1.00
R1966:Clcn4 UTSW 7 7284185 makesense probably null
R2764:Clcn4 UTSW 7 7296799 missense possibly damaging 0.81
R2874:Clcn4 UTSW 7 7290521 missense probably benign 0.33
R4023:Clcn4 UTSW 7 7290428 missense probably damaging 1.00
R4024:Clcn4 UTSW 7 7290428 missense probably damaging 1.00
R4152:Clcn4 UTSW 7 7294834 missense probably benign 0.02
R4154:Clcn4 UTSW 7 7294834 missense probably benign 0.02
R4298:Clcn4 UTSW 7 7296738 missense possibly damaging 0.93
R4535:Clcn4 UTSW 7 7287814 missense probably benign 0.01
R4574:Clcn4 UTSW 7 7287805 missense probably benign 0.23
R4977:Clcn4 UTSW 7 7291437 missense probably benign 0.00
R5158:Clcn4 UTSW 7 7291619 missense possibly damaging 0.94
R5302:Clcn4 UTSW 7 7294051 missense possibly damaging 0.95
R5369:Clcn4 UTSW 7 7296033 missense probably benign 0.26
R5624:Clcn4 UTSW 7 7288944 missense probably benign 0.35
R5626:Clcn4 UTSW 7 7289018 missense probably damaging 1.00
R5723:Clcn4 UTSW 7 7291682 missense probably damaging 1.00
R6154:Clcn4 UTSW 7 7291482 missense probably benign 0.00
R6259:Clcn4 UTSW 7 7291530 missense possibly damaging 0.92
R6396:Clcn4 UTSW 7 7294025 missense probably damaging 1.00
R6783:Clcn4 UTSW 7 7299182 unclassified probably benign
R7320:Clcn4 UTSW 7 7291828 missense probably benign 0.19
R7562:Clcn4 UTSW 7 7295082 missense possibly damaging 0.92
R7586:Clcn4 UTSW 7 7293959 missense probably benign 0.00
R7752:Clcn4 UTSW 7 7293937 missense probably benign
R7860:Clcn4 UTSW 7 7293061 missense probably damaging 1.00
R7872:Clcn4 UTSW 7 7287781 missense probably benign
R8069:Clcn4 UTSW 7 7296759 missense probably damaging 0.99
R8083:Clcn4 UTSW 7 7291428 missense possibly damaging 0.69
X0019:Clcn4 UTSW 7 7291610 missense probably damaging 1.00
Z1177:Clcn4 UTSW 7 7293040 nonsense probably null
Z1177:Clcn4 UTSW 7 7294756 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GACTGGCTCAGAAGAAGCTCTG -3'
(R):5'- TTCCTCAACCAGTTCTGCGAG -3'

Sequencing Primer
(F):5'- GAAGAAGCTCTGACCACTTCTG -3'
(R):5'- AACCAGTTCTGCGAGCATGTG -3'
Posted On2019-12-20