Incidental Mutation 'R0681:Ogfod2'
ID60964
Institutional Source Beutler Lab
Gene Symbol Ogfod2
Ensembl Gene ENSMUSG00000023707
Gene Name2-oxoglutarate and iron-dependent oxygenase domain containing 2
Synonyms
MMRRC Submission 038866-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R0681 (G1)
Quality Score122
Status Validated
Chromosome5
Chromosomal Location124112297-124115483 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124112844 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 62 (E62G)
Ref Sequence ENSEMBL: ENSMUSP00000143698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024470] [ENSMUST00000031351] [ENSMUST00000119269] [ENSMUST00000122394] [ENSMUST00000145667] [ENSMUST00000149835] [ENSMUST00000196401] [ENSMUST00000196627] [ENSMUST00000198505] [ENSMUST00000198770]
Predicted Effect probably null
Transcript: ENSMUST00000024470
AA Change: E62G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024470
Gene: ENSMUSG00000023707
AA Change: E62G

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Blast:P4Hc 42 100 2e-6 BLAST
low complexity region 102 112 N/A INTRINSIC
P4Hc 136 307 7.91e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000031351
SMART Domains Protein: ENSMUSP00000031351
Gene: ENSMUSG00000029404

DomainStartEndE-ValueType
Pfam:SR-25 7 227 2.7e-104 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119269
AA Change: E62G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112701
Gene: ENSMUSG00000023707
AA Change: E62G

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Blast:P4Hc 42 133 1e-22 BLAST
Blast:P4Hc 136 175 1e-20 BLAST
low complexity region 176 187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122394
SMART Domains Protein: ENSMUSP00000112506
Gene: ENSMUSG00000029404

DomainStartEndE-ValueType
Pfam:SR-25 2 199 6.3e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127989
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130140
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143062
Predicted Effect probably benign
Transcript: ENSMUST00000145667
SMART Domains Protein: ENSMUSP00000122377
Gene: ENSMUSG00000029404

DomainStartEndE-ValueType
Pfam:SR-25 19 227 3e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148365
Predicted Effect probably benign
Transcript: ENSMUST00000149835
SMART Domains Protein: ENSMUSP00000116269
Gene: ENSMUSG00000029404

DomainStartEndE-ValueType
low complexity region 5 32 N/A INTRINSIC
SCOP:d1l9ha_ 58 84 7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196401
SMART Domains Protein: ENSMUSP00000142496
Gene: ENSMUSG00000029404

DomainStartEndE-ValueType
low complexity region 29 50 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000196627
AA Change: E62G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143698
Gene: ENSMUSG00000023707
AA Change: E62G

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Blast:P4Hc 42 133 1e-23 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000198505
AA Change: S56G
SMART Domains Protein: ENSMUSP00000142965
Gene: ENSMUSG00000023707
AA Change: S56G

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198770
AA Change: E31G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143318
Gene: ENSMUSG00000023707
AA Change: E31G

DomainStartEndE-ValueType
Blast:P4Hc 11 102 7e-24 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000199457
AA Change: E61G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.5562 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 G T 8: 83,934,650 probably benign Het
Adgrv1 C A 13: 81,528,530 D1341Y probably damaging Het
Ahdc1 T C 4: 133,065,516 F1356S possibly damaging Het
BC027072 T G 17: 71,749,514 H1056P probably benign Het
Cdk13 A G 13: 17,721,297 probably benign Het
Cfhr1 A T 1: 139,557,511 S66T probably damaging Het
Cldn6 C A 17: 23,681,193 Q44K probably damaging Het
Cntnap5c T C 17: 58,305,555 V863A possibly damaging Het
Col6a4 T A 9: 106,067,144 K1044* probably null Het
Cyb561d1 A G 3: 108,199,267 V212A probably benign Het
Cyp1b1 A G 17: 79,713,846 S156P probably damaging Het
Dock7 G A 4: 99,016,704 H645Y probably damaging Het
Dpp3 T C 19: 4,914,654 N542D probably damaging Het
Fastkd3 C T 13: 68,591,928 probably benign Het
Galnt10 T A 11: 57,769,540 V268D probably damaging Het
Gm13078 A T 4: 143,728,052 T307S probably benign Het
Grb14 G T 2: 64,917,287 A10E probably damaging Het
Grin2c A G 11: 115,249,653 V1213A probably benign Het
Grip1 C T 10: 120,010,230 T570I probably damaging Het
Hif1an T C 19: 44,563,323 Y71H probably benign Het
Hsd17b11 T A 5: 104,003,206 I221L probably benign Het
Htra1 A T 7: 130,979,297 probably benign Het
Igfn1 T C 1: 135,963,853 E2308G possibly damaging Het
Mapk9 T A 11: 49,869,245 S129T probably damaging Het
Med22 T C 2: 26,910,379 T13A probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mtus1 A T 8: 40,993,517 L489Q probably damaging Het
Naprt G A 15: 75,893,632 P120S probably damaging Het
Nwd1 C T 8: 72,662,337 P172L probably damaging Het
Olfr1445 T C 19: 12,884,079 L66P probably damaging Het
Olfr1445 A G 19: 12,884,546 T222A probably damaging Het
Olfr211 A T 6: 116,494,400 S264C probably damaging Het
Palm A C 10: 79,819,493 T362P probably benign Het
Pcdh8 T C 14: 79,769,960 T388A probably benign Het
Pclo A G 5: 14,675,318 I1397V unknown Het
Per1 A G 11: 69,101,201 E127G probably damaging Het
Plekha1 T C 7: 130,900,623 V30A possibly damaging Het
Rab26 A G 17: 24,527,966 probably benign Het
Rasal2 T C 1: 157,157,180 D999G possibly damaging Het
Rfx5 C T 3: 94,956,355 T105I probably damaging Het
Rrp1b T C 17: 32,060,395 S677P probably damaging Het
Scaf4 G A 16: 90,249,694 P485S unknown Het
Scn5a A T 9: 119,539,640 M273K probably damaging Het
Sec22a C T 16: 35,361,556 probably null Het
Slc10a6 C A 5: 103,612,449 V227F possibly damaging Het
Slc39a3 C G 10: 81,033,731 E31Q probably benign Het
Spsb1 C T 4: 149,906,917 V65I probably benign Het
Tdrd7 T A 4: 46,016,879 M673K probably benign Het
Trim8 C A 19: 46,515,093 S361R possibly damaging Het
Ucp1 T A 8: 83,295,307 M256K possibly damaging Het
Vmn1r46 A T 6: 89,976,964 D265V probably damaging Het
Zbtb5 T C 4: 44,993,787 I532M probably damaging Het
Other mutations in Ogfod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02305:Ogfod2 APN 5 124112847 critical splice donor site probably null
IGL03304:Ogfod2 APN 5 124112823 missense probably damaging 0.99
R0018:Ogfod2 UTSW 5 124114525 unclassified probably benign
R0751:Ogfod2 UTSW 5 124113476 unclassified probably benign
R1744:Ogfod2 UTSW 5 124114156 unclassified probably null
R1800:Ogfod2 UTSW 5 124114956 missense probably damaging 1.00
R2211:Ogfod2 UTSW 5 124112780 splice site probably null
R3977:Ogfod2 UTSW 5 124113209 splice site probably null
R4346:Ogfod2 UTSW 5 124113294 missense probably damaging 1.00
R4508:Ogfod2 UTSW 5 124113254 nonsense probably null
R4537:Ogfod2 UTSW 5 124114528 unclassified probably benign
R5795:Ogfod2 UTSW 5 124114761 missense probably damaging 1.00
R6647:Ogfod2 UTSW 5 124114803 missense possibly damaging 0.95
R7101:Ogfod2 UTSW 5 124114495 missense unknown
R8001:Ogfod2 UTSW 5 124114883 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGGCTTTGCCCGAGTGTGCAAC -3'
(R):5'- TCTTAAACCTGACACTGCCCACTGC -3'

Sequencing Primer
(F):5'- AGCAGATCTTTCGGTGACC -3'
(R):5'- TGTCAAGGCGACCTGACAG -3'
Posted On2013-07-30