Incidental Mutation 'R7896:Slc9a8'
ID609663
Institutional Source Beutler Lab
Gene Symbol Slc9a8
Ensembl Gene ENSMUSG00000039463
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 8
Synonyms1200006P13Rik, 6430709P13Rik, NHE8
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7896 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location167421712-167477000 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 167465358 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 321 (F321L)
Ref Sequence ENSEMBL: ENSMUSP00000044185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047815] [ENSMUST00000073873] [ENSMUST00000109218]
Predicted Effect probably benign
Transcript: ENSMUST00000047815
AA Change: F321L

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000044185
Gene: ENSMUSG00000039463
AA Change: F321L

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 57 468 3.3e-69 PFAM
low complexity region 497 513 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073873
AA Change: F294L

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000073536
Gene: ENSMUSG00000039463
AA Change: F294L

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 54 441 3.5e-62 PFAM
low complexity region 470 486 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109218
AA Change: F290L

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000104841
Gene: ENSMUSG00000039463
AA Change: F290L

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 54 437 3.7e-61 PFAM
low complexity region 466 482 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: This gene encodes a member of the Na+/H+ exchanger (NHE) family of integral membrane transporter proteins. The encoded protein is expressed on the apical membrane of the intestinal epithelial cells and plays an important role in mucosal protection. Loss of the encoded protein in mice results in a decrease in the number of goblet and mucin-positive cells, disorganization of the mucin layer, and a decrease in mucosal pH in the colon. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male infertility, impaired mucin synthesis and bicarbonate secretion in the colon, abnormal blood coagulation and increased length of the small intestine, cecum and ileum crypts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A G 10: 80,004,958 T894A probably damaging Het
Abcc10 T A 17: 46,324,309 H256L probably benign Het
Abcc6 A G 7: 45,977,379 L1418P probably damaging Het
Actn2 G A 13: 12,294,317 A290V possibly damaging Het
Actrt2 A T 4: 154,667,195 D161E probably benign Het
Adam19 T A 11: 46,137,543 C668S probably damaging Het
Alg8 T C 7: 97,390,916 L435S probably damaging Het
Amz2 G A 11: 109,436,587 E322K possibly damaging Het
Ankrd12 T A 17: 65,985,685 R918* probably null Het
Atp5f1 A G 3: 105,955,943 I59T probably damaging Het
Bach1 T A 16: 87,719,005 C145S possibly damaging Het
Bcl6b G T 11: 70,227,022 S309* probably null Het
Birc6 G T 17: 74,622,082 R2323L probably damaging Het
Catspere2 A T 1: 178,111,174 M538L probably benign Het
Ccdc154 A T 17: 25,171,826 M647L probably benign Het
Cdc14a T C 3: 116,294,833 T447A probably benign Het
Chst9 C T 18: 15,452,789 R239H probably damaging Het
Cs C T 10: 128,353,135 A171V probably damaging Het
D3Ertd751e T A 3: 41,756,073 F107I probably benign Het
D430041D05Rik T C 2: 104,258,040 D197G probably benign Het
Dcdc2c G A 12: 28,470,620 Q486* probably null Het
Dolk A T 2: 30,285,949 V28E possibly damaging Het
Dpf2 C T 19: 5,904,305 S191N probably benign Het
Eml3 T A 19: 8,933,807 F267I possibly damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam189a1 T C 7: 64,776,809 H232R probably damaging Het
Foxo3 T C 10: 42,197,736 S262G possibly damaging Het
Gm1527 T G 3: 28,921,593 probably null Het
Gm49380 G A 9: 44,112,799 L51F probably damaging Het
Gm9195 A T 14: 72,455,738 H1582Q unknown Het
Gm9573 G A 17: 35,620,025 P1090S unknown Het
Grip1 A G 10: 119,978,545 Q327R possibly damaging Het
Gstt1 A G 10: 75,784,142 F207S probably damaging Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Kif16b A G 2: 142,834,075 probably null Het
Kif5a A G 10: 127,242,004 V407A probably benign Het
Lrrc57 C A 2: 120,607,891 D134Y probably damaging Het
Map1a A G 2: 121,305,176 T2158A probably benign Het
Mink1 A G 11: 70,612,282 N1068S possibly damaging Het
Mmp8 A T 9: 7,564,977 I295F probably damaging Het
Mup18 G T 4: 61,672,688 probably null Het
Myo1h G T 5: 114,336,311 probably null Het
Nap1l5 C T 6: 58,906,520 G52S probably damaging Het
Npr3 A G 15: 11,883,362 F327S probably damaging Het
Nrxn2 C A 19: 6,532,053 Q1673K possibly damaging Het
Olfr457 T A 6: 42,472,166 D4V probably benign Het
Olfr53 G T 7: 140,652,901 L307F probably benign Het
Paf1 T C 7: 28,396,647 Y260H probably damaging Het
Pcmtd2 T C 2: 181,854,983 I251T probably damaging Het
Pde9a C T 17: 31,459,967 Q261* probably null Het
Ppip5k1 T C 2: 121,347,330 D332G probably damaging Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Ppp1r36 A G 12: 76,428,149 probably null Het
Pprc1 T C 19: 46,061,449 L67P unknown Het
Prkdc T G 16: 15,708,903 L1346R probably damaging Het
Prl7c1 A T 13: 27,778,087 M79K possibly damaging Het
Ptprb C T 10: 116,369,457 probably null Het
R3hdm1 T A 1: 128,168,966 probably null Het
Ralgapa1 A G 12: 55,697,878 V1276A probably benign Het
Rapsn T C 2: 91,044,955 L361P probably benign Het
Rbm22 G T 18: 60,569,433 A275S probably benign Het
Rsph3a A G 17: 7,946,108 Y100C probably damaging Het
Rsrp1 A T 4: 134,923,963 M13L unknown Het
Rtn4 T G 11: 29,705,536 D169E probably damaging Het
Setd7 C A 3: 51,536,656 probably null Het
Slc38a2 A G 15: 96,693,585 I206T probably damaging Het
Sppl2c A G 11: 104,187,130 D252G possibly damaging Het
Srgap1 CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC 10: 121,853,553 probably benign Het
Syne2 A G 12: 76,035,623 T117A probably damaging Het
Szt2 A T 4: 118,402,913 F79I possibly damaging Het
Tlr3 T A 8: 45,397,053 K860* probably null Het
Ttn T C 2: 76,794,674 S15187G probably benign Het
Ubr5 A G 15: 38,041,573 V204A probably benign Het
Unc5c A T 3: 141,771,161 T363S possibly damaging Het
Usp40 G A 1: 87,978,479 T678I possibly damaging Het
Vmn1r62 A T 7: 5,675,610 T97S probably damaging Het
Vmn1r85 T A 7: 13,084,521 H232L probably benign Het
Vmn2r67 A G 7: 85,136,712 I695T probably damaging Het
Zfp383 C A 7: 29,912,201 D35E probably damaging Het
Zfp65 A T 13: 67,729,055 probably null Het
Zfp692 A G 11: 58,314,236 K437R probably damaging Het
Zfp831 A T 2: 174,647,128 T1199S possibly damaging Het
Zfr T A 15: 12,146,377 I338N probably damaging Het
Other mutations in Slc9a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Slc9a8 APN 2 167424166 missense possibly damaging 0.46
IGL02626:Slc9a8 APN 2 167467677 splice site probably benign
costello UTSW 2 167451296 missense probably damaging 1.00
R0270:Slc9a8 UTSW 2 167451296 missense probably damaging 1.00
R0417:Slc9a8 UTSW 2 167457344 missense probably benign 0.00
R0504:Slc9a8 UTSW 2 167424205 missense probably benign
R0906:Slc9a8 UTSW 2 167434867 intron probably benign
R1216:Slc9a8 UTSW 2 167424121 missense probably benign 0.00
R1225:Slc9a8 UTSW 2 167471523 missense probably benign 0.20
R1604:Slc9a8 UTSW 2 167471432 missense probably benign 0.09
R1728:Slc9a8 UTSW 2 167424145 missense probably benign 0.00
R1729:Slc9a8 UTSW 2 167424145 missense probably benign 0.00
R1773:Slc9a8 UTSW 2 167471465 missense possibly damaging 0.57
R1775:Slc9a8 UTSW 2 167457358 missense probably benign 0.12
R1918:Slc9a8 UTSW 2 167424214 missense possibly damaging 0.95
R2312:Slc9a8 UTSW 2 167451276 missense probably benign 0.01
R3031:Slc9a8 UTSW 2 167451281 missense probably damaging 1.00
R3752:Slc9a8 UTSW 2 167457352 missense probably benign
R3757:Slc9a8 UTSW 2 167424130 missense probably benign 0.01
R4499:Slc9a8 UTSW 2 167424193 missense probably benign 0.01
R4746:Slc9a8 UTSW 2 167441170 nonsense probably null
R4904:Slc9a8 UTSW 2 167471396 missense possibly damaging 0.51
R4969:Slc9a8 UTSW 2 167446529 missense probably benign 0.06
R5395:Slc9a8 UTSW 2 167467722 missense probably damaging 0.99
R5811:Slc9a8 UTSW 2 167471387 nonsense probably null
R5908:Slc9a8 UTSW 2 167451170 intron probably benign
R6311:Slc9a8 UTSW 2 167451220 missense probably damaging 1.00
R6443:Slc9a8 UTSW 2 167434821 missense probably benign 0.00
R6494:Slc9a8 UTSW 2 167424291 missense probably damaging 1.00
R7161:Slc9a8 UTSW 2 167465383 missense possibly damaging 0.90
R7322:Slc9a8 UTSW 2 167451302 missense probably damaging 1.00
R7354:Slc9a8 UTSW 2 167474131 missense possibly damaging 0.93
R8095:Slc9a8 UTSW 2 167468971 missense probably damaging 0.99
R8725:Slc9a8 UTSW 2 167473534 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAACCGCATGTCCATTTCTCTG -3'
(R):5'- CCCTGCTGCCAAGAAGAATC -3'

Sequencing Primer
(F):5'- CTGACACTCTTGGATGCCAGAAG -3'
(R):5'- TGCTGCCAAGAAGAATCCTAGC -3'
Posted On2019-12-20