Incidental Mutation 'R0681:Plekha1'
ID60967
Institutional Source Beutler Lab
Gene Symbol Plekha1
Ensembl Gene ENSMUSG00000040268
Gene Namepleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1
SynonymsTAPP1, C920009D07Rik
MMRRC Submission 038866-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R0681 (G1)
Quality Score133
Status Validated
Chromosome7
Chromosomal Location130865756-130913312 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130900623 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 30 (V30A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048180] [ENSMUST00000075181] [ENSMUST00000120441] [ENSMUST00000124096] [ENSMUST00000151119]
Predicted Effect probably benign
Transcript: ENSMUST00000048180
AA Change: V144A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000035375
Gene: ENSMUSG00000040268
AA Change: V144A

DomainStartEndE-ValueType
PDB:1V5P|A 1 75 2e-33 PDB
Blast:PH 8 78 1e-36 BLAST
PH 144 243 1.71e-21 SMART
low complexity region 244 261 N/A INTRINSIC
low complexity region 268 287 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075181
AA Change: V192A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000074675
Gene: ENSMUSG00000040268
AA Change: V192A

DomainStartEndE-ValueType
PH 8 114 2.16e-9 SMART
PH 192 291 1.71e-21 SMART
low complexity region 330 341 N/A INTRINSIC
low complexity region 370 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120441
AA Change: V192A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000112777
Gene: ENSMUSG00000040268
AA Change: V192A

DomainStartEndE-ValueType
PH 8 114 2.16e-9 SMART
PH 192 291 1.71e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126355
SMART Domains Protein: ENSMUSP00000114411
Gene: ENSMUSG00000040268

DomainStartEndE-ValueType
Pfam:PH 2 51 6e-8 PFAM
low complexity region 102 113 N/A INTRINSIC
low complexity region 142 153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135359
Predicted Effect possibly damaging
Transcript: ENSMUST00000136963
AA Change: V30A

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149029
Predicted Effect probably benign
Transcript: ENSMUST00000151119
AA Change: V192A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000123600
Gene: ENSMUSG00000040268
AA Change: V192A

DomainStartEndE-ValueType
PDB:1V5P|A 1 67 3e-35 PDB
Blast:PH 8 67 7e-38 BLAST
Meta Mutation Damage Score 0.1406 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pleckstrin homology domain-containing adapter protein. The encoded protein is localized to the plasma membrane where it specifically binds phosphatidylinositol 3,4-bisphosphate. This protein may be involved in the formation of signaling complexes in the plasma membrane. Polymorphisms in this gene are associated with age-related macular degeneration. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 5.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mcie homozygous for a gene trapped allele exhibit postnatal lethality and increased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 G T 8: 83,934,650 probably benign Het
Adgrv1 C A 13: 81,528,530 D1341Y probably damaging Het
Ahdc1 T C 4: 133,065,516 F1356S possibly damaging Het
BC027072 T G 17: 71,749,514 H1056P probably benign Het
Cdk13 A G 13: 17,721,297 probably benign Het
Cfhr1 A T 1: 139,557,511 S66T probably damaging Het
Cldn6 C A 17: 23,681,193 Q44K probably damaging Het
Cntnap5c T C 17: 58,305,555 V863A possibly damaging Het
Col6a4 T A 9: 106,067,144 K1044* probably null Het
Cyb561d1 A G 3: 108,199,267 V212A probably benign Het
Cyp1b1 A G 17: 79,713,846 S156P probably damaging Het
Dock7 G A 4: 99,016,704 H645Y probably damaging Het
Dpp3 T C 19: 4,914,654 N542D probably damaging Het
Fastkd3 C T 13: 68,591,928 probably benign Het
Galnt10 T A 11: 57,769,540 V268D probably damaging Het
Gm13078 A T 4: 143,728,052 T307S probably benign Het
Grb14 G T 2: 64,917,287 A10E probably damaging Het
Grin2c A G 11: 115,249,653 V1213A probably benign Het
Grip1 C T 10: 120,010,230 T570I probably damaging Het
Hif1an T C 19: 44,563,323 Y71H probably benign Het
Hsd17b11 T A 5: 104,003,206 I221L probably benign Het
Htra1 A T 7: 130,979,297 probably benign Het
Igfn1 T C 1: 135,963,853 E2308G possibly damaging Het
Mapk9 T A 11: 49,869,245 S129T probably damaging Het
Med22 T C 2: 26,910,379 T13A probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mtus1 A T 8: 40,993,517 L489Q probably damaging Het
Naprt G A 15: 75,893,632 P120S probably damaging Het
Nwd1 C T 8: 72,662,337 P172L probably damaging Het
Ogfod2 A G 5: 124,112,844 E62G probably null Het
Olfr1445 T C 19: 12,884,079 L66P probably damaging Het
Olfr1445 A G 19: 12,884,546 T222A probably damaging Het
Olfr211 A T 6: 116,494,400 S264C probably damaging Het
Palm A C 10: 79,819,493 T362P probably benign Het
Pcdh8 T C 14: 79,769,960 T388A probably benign Het
Pclo A G 5: 14,675,318 I1397V unknown Het
Per1 A G 11: 69,101,201 E127G probably damaging Het
Rab26 A G 17: 24,527,966 probably benign Het
Rasal2 T C 1: 157,157,180 D999G possibly damaging Het
Rfx5 C T 3: 94,956,355 T105I probably damaging Het
Rrp1b T C 17: 32,060,395 S677P probably damaging Het
Scaf4 G A 16: 90,249,694 P485S unknown Het
Scn5a A T 9: 119,539,640 M273K probably damaging Het
Sec22a C T 16: 35,361,556 probably null Het
Slc10a6 C A 5: 103,612,449 V227F possibly damaging Het
Slc39a3 C G 10: 81,033,731 E31Q probably benign Het
Spsb1 C T 4: 149,906,917 V65I probably benign Het
Tdrd7 T A 4: 46,016,879 M673K probably benign Het
Trim8 C A 19: 46,515,093 S361R possibly damaging Het
Ucp1 T A 8: 83,295,307 M256K possibly damaging Het
Vmn1r46 A T 6: 89,976,964 D265V probably damaging Het
Zbtb5 T C 4: 44,993,787 I532M probably damaging Het
Other mutations in Plekha1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Plekha1 APN 7 130877839 missense probably damaging 1.00
IGL00973:Plekha1 APN 7 130911013 missense probably damaging 0.96
IGL01010:Plekha1 APN 7 130902254 splice site probably benign
IGL01726:Plekha1 APN 7 130897329 missense probably damaging 1.00
R0137:Plekha1 UTSW 7 130897446 missense probably damaging 0.98
R1304:Plekha1 UTSW 7 130902219 missense probably benign
R1786:Plekha1 UTSW 7 130892253 missense probably benign 0.02
R2036:Plekha1 UTSW 7 130902192 missense probably damaging 1.00
R2844:Plekha1 UTSW 7 130908365 missense probably damaging 1.00
R2845:Plekha1 UTSW 7 130908365 missense probably damaging 1.00
R2846:Plekha1 UTSW 7 130908365 missense probably damaging 1.00
R5119:Plekha1 UTSW 7 130905364 intron probably benign
R5167:Plekha1 UTSW 7 130885449 critical splice donor site probably null
R5470:Plekha1 UTSW 7 130908376 missense probably damaging 1.00
R5536:Plekha1 UTSW 7 130909601 missense probably damaging 0.96
R5975:Plekha1 UTSW 7 130892253 missense probably benign 0.02
R6087:Plekha1 UTSW 7 130900571 missense probably benign 0.06
R6346:Plekha1 UTSW 7 130877782 missense probably benign 0.17
R7581:Plekha1 UTSW 7 130910865 missense probably benign
R8152:Plekha1 UTSW 7 130908372 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGTTGAGATTAAGTGTCACAGGCT -3'
(R):5'- TGATAATCATGGGGCAAACCCTCTACA -3'

Sequencing Primer
(F):5'- CACAGGCTTACATTTTTTCTGAGG -3'
(R):5'- GGCAAACCCTCTACACCCTTC -3'
Posted On2013-07-30